ID: 979895353

View in Genome Browser
Species Human (GRCh38)
Location 4:126149807-126149829
Sequence GCAAGTCCTGCTTTTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979895353_979895362 -1 Left 979895353 4:126149807-126149829 CCCCCTAGAAAAGCAGGACTTGC No data
Right 979895362 4:126149829-126149851 CCACTAAGGGTGAAGGAGAAGGG 0: 143
1: 304
2: 349
3: 426
4: 493
979895353_979895360 -2 Left 979895353 4:126149807-126149829 CCCCCTAGAAAAGCAGGACTTGC No data
Right 979895360 4:126149828-126149850 GCCACTAAGGGTGAAGGAGAAGG 0: 148
1: 295
2: 218
3: 88
4: 242
979895353_979895363 0 Left 979895353 4:126149807-126149829 CCCCCTAGAAAAGCAGGACTTGC No data
Right 979895363 4:126149830-126149852 CACTAAGGGTGAAGGAGAAGGGG 0: 147
1: 289
2: 224
3: 98
4: 363
979895353_979895365 7 Left 979895353 4:126149807-126149829 CCCCCTAGAAAAGCAGGACTTGC No data
Right 979895365 4:126149837-126149859 GGTGAAGGAGAAGGGGTTCAGGG No data
979895353_979895364 6 Left 979895353 4:126149807-126149829 CCCCCTAGAAAAGCAGGACTTGC No data
Right 979895364 4:126149836-126149858 GGGTGAAGGAGAAGGGGTTCAGG No data
979895353_979895359 -8 Left 979895353 4:126149807-126149829 CCCCCTAGAAAAGCAGGACTTGC No data
Right 979895359 4:126149822-126149844 GGACTTGCCACTAAGGGTGAAGG 0: 212
1: 594
2: 424
3: 169
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979895353 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG (reversed) Intergenic
No off target data available for this crispr