ID: 979896685

View in Genome Browser
Species Human (GRCh38)
Location 4:126166571-126166593
Sequence GTCTCAAAACTGCTAATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979896677_979896685 24 Left 979896677 4:126166524-126166546 CCAGTTCATTTCAGAACACTCCT No data
Right 979896685 4:126166571-126166593 GTCTCAAAACTGCTAATAAAGGG No data
979896676_979896685 25 Left 979896676 4:126166523-126166545 CCCAGTTCATTTCAGAACACTCC No data
Right 979896685 4:126166571-126166593 GTCTCAAAACTGCTAATAAAGGG No data
979896680_979896685 4 Left 979896680 4:126166544-126166566 CCTTTTTTCCATATGGGTCCCTG No data
Right 979896685 4:126166571-126166593 GTCTCAAAACTGCTAATAAAGGG No data
979896681_979896685 -4 Left 979896681 4:126166552-126166574 CCATATGGGTCCCTGAAGTGTCT No data
Right 979896685 4:126166571-126166593 GTCTCAAAACTGCTAATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979896685 Original CRISPR GTCTCAAAACTGCTAATAAA GGG Intergenic
No off target data available for this crispr