ID: 979899910

View in Genome Browser
Species Human (GRCh38)
Location 4:126202594-126202616
Sequence GGGACCTGCCCCATCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979899902_979899910 27 Left 979899902 4:126202544-126202566 CCAGTTTTCAGGCTTCAGGCTGT No data
Right 979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG No data
979899901_979899910 28 Left 979899901 4:126202543-126202565 CCCAGTTTTCAGGCTTCAGGCTG No data
Right 979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979899910 Original CRISPR GGGACCTGCCCCATCTGCCC AGG Intergenic
No off target data available for this crispr