ID: 979904459

View in Genome Browser
Species Human (GRCh38)
Location 4:126269087-126269109
Sequence TTTCCACTCTTTAGAGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979904458_979904459 1 Left 979904458 4:126269063-126269085 CCTTTCTTCAAGGGTTGGAGTTT No data
Right 979904459 4:126269087-126269109 TTTCCACTCTTTAGAGTGTGAGG No data
979904454_979904459 18 Left 979904454 4:126269046-126269068 CCATATTCTTTGATACTCCTTTC No data
Right 979904459 4:126269087-126269109 TTTCCACTCTTTAGAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979904459 Original CRISPR TTTCCACTCTTTAGAGTGTG AGG Intergenic
No off target data available for this crispr