ID: 979906900

View in Genome Browser
Species Human (GRCh38)
Location 4:126305551-126305573
Sequence ATGTCACTCTAGTAACATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979906897_979906900 19 Left 979906897 4:126305509-126305531 CCCATGTCAGAGTCAAGAGGATT No data
Right 979906900 4:126305551-126305573 ATGTCACTCTAGTAACATGACGG No data
979906898_979906900 18 Left 979906898 4:126305510-126305532 CCATGTCAGAGTCAAGAGGATTT No data
Right 979906900 4:126305551-126305573 ATGTCACTCTAGTAACATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979906900 Original CRISPR ATGTCACTCTAGTAACATGA CGG Intergenic
No off target data available for this crispr