ID: 979911067

View in Genome Browser
Species Human (GRCh38)
Location 4:126366282-126366304
Sequence AATCTTCAAGTTTGAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979911067_979911071 -10 Left 979911067 4:126366282-126366304 CCCCTTCCTCAAACTTGAAGATT No data
Right 979911071 4:126366295-126366317 CTTGAAGATTGCTTGTAGCCAGG No data
979911067_979911074 22 Left 979911067 4:126366282-126366304 CCCCTTCCTCAAACTTGAAGATT No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979911067 Original CRISPR AATCTTCAAGTTTGAGGAAG GGG (reversed) Intergenic
No off target data available for this crispr