ID: 979911068

View in Genome Browser
Species Human (GRCh38)
Location 4:126366283-126366305
Sequence CAATCTTCAAGTTTGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979911068_979911074 21 Left 979911068 4:126366283-126366305 CCCTTCCTCAAACTTGAAGATTG No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979911068 Original CRISPR CAATCTTCAAGTTTGAGGAA GGG (reversed) Intergenic
No off target data available for this crispr