ID: 979911070

View in Genome Browser
Species Human (GRCh38)
Location 4:126366288-126366310
Sequence ACAAGCAATCTTCAAGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979911070_979911074 16 Left 979911070 4:126366288-126366310 CCTCAAACTTGAAGATTGCTTGT No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979911070 Original CRISPR ACAAGCAATCTTCAAGTTTG AGG (reversed) Intergenic
No off target data available for this crispr