ID: 979911072

View in Genome Browser
Species Human (GRCh38)
Location 4:126366313-126366335
Sequence ATGTGATTATTTAGGATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979911072_979911074 -9 Left 979911072 4:126366313-126366335 CCAGGAATCCTAAATAATCACAT No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979911072 Original CRISPR ATGTGATTATTTAGGATTCC TGG (reversed) Intergenic
No off target data available for this crispr