ID: 979911074

View in Genome Browser
Species Human (GRCh38)
Location 4:126366327-126366349
Sequence TAATCACATTACCTATCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979911072_979911074 -9 Left 979911072 4:126366313-126366335 CCAGGAATCCTAAATAATCACAT No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data
979911069_979911074 20 Left 979911069 4:126366284-126366306 CCTTCCTCAAACTTGAAGATTGC No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data
979911070_979911074 16 Left 979911070 4:126366288-126366310 CCTCAAACTTGAAGATTGCTTGT No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data
979911068_979911074 21 Left 979911068 4:126366283-126366305 CCCTTCCTCAAACTTGAAGATTG No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data
979911067_979911074 22 Left 979911067 4:126366282-126366304 CCCCTTCCTCAAACTTGAAGATT No data
Right 979911074 4:126366327-126366349 TAATCACATTACCTATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979911074 Original CRISPR TAATCACATTACCTATCTTC TGG Intergenic
No off target data available for this crispr