ID: 979913506

View in Genome Browser
Species Human (GRCh38)
Location 4:126401737-126401759
Sequence GAATTATATTGCCTGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979913506_979913509 23 Left 979913506 4:126401737-126401759 CCTGAAATCAGGCAATATAATTC No data
Right 979913509 4:126401783-126401805 ATGAATATTTGAATGATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979913506 Original CRISPR GAATTATATTGCCTGATTTC AGG (reversed) Intergenic
No off target data available for this crispr