ID: 979913508

View in Genome Browser
Species Human (GRCh38)
Location 4:126401762-126401784
Sequence ATAAAATACAGTATCAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979913508_979913510 11 Left 979913508 4:126401762-126401784 CCAACATTGATACTGTATTTTAT No data
Right 979913510 4:126401796-126401818 TGATTACTGGTACTATACATTGG No data
979913508_979913509 -2 Left 979913508 4:126401762-126401784 CCAACATTGATACTGTATTTTAT No data
Right 979913509 4:126401783-126401805 ATGAATATTTGAATGATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979913508 Original CRISPR ATAAAATACAGTATCAATGT TGG (reversed) Intergenic
No off target data available for this crispr