ID: 979913509

View in Genome Browser
Species Human (GRCh38)
Location 4:126401783-126401805
Sequence ATGAATATTTGAATGATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979913507_979913509 1 Left 979913507 4:126401759-126401781 CCTCCAACATTGATACTGTATTT No data
Right 979913509 4:126401783-126401805 ATGAATATTTGAATGATTACTGG No data
979913508_979913509 -2 Left 979913508 4:126401762-126401784 CCAACATTGATACTGTATTTTAT No data
Right 979913509 4:126401783-126401805 ATGAATATTTGAATGATTACTGG No data
979913506_979913509 23 Left 979913506 4:126401737-126401759 CCTGAAATCAGGCAATATAATTC No data
Right 979913509 4:126401783-126401805 ATGAATATTTGAATGATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979913509 Original CRISPR ATGAATATTTGAATGATTAC TGG Intergenic
No off target data available for this crispr