ID: 979914874

View in Genome Browser
Species Human (GRCh38)
Location 4:126418980-126419002
Sequence ACTTATAGACTGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979914874_979914878 8 Left 979914874 4:126418980-126419002 CCCTTTACCTTCAGTCTATAAGT No data
Right 979914878 4:126419011-126419033 AGGCCAAGTGAGTTGCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979914874 Original CRISPR ACTTATAGACTGAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr