ID: 979920023

View in Genome Browser
Species Human (GRCh38)
Location 4:126484846-126484868
Sequence GTGTAGGAATGGTGGTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979920023_979920028 24 Left 979920023 4:126484846-126484868 CCTCTTTACCACCATTCCTACAC No data
Right 979920028 4:126484893-126484915 ATGAAGCAAATAATAGAATTTGG No data
979920023_979920029 25 Left 979920023 4:126484846-126484868 CCTCTTTACCACCATTCCTACAC No data
Right 979920029 4:126484894-126484916 TGAAGCAAATAATAGAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979920023 Original CRISPR GTGTAGGAATGGTGGTAAAG AGG (reversed) Intergenic
No off target data available for this crispr