ID: 979924431

View in Genome Browser
Species Human (GRCh38)
Location 4:126542997-126543019
Sequence TTAAATAGTGAAATTCCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979924431_979924436 19 Left 979924431 4:126542997-126543019 CCCTTAGGAATTTCACTATTTAA No data
Right 979924436 4:126543039-126543061 CAACAAGGAAACTGAGAATTAGG No data
979924431_979924438 30 Left 979924431 4:126542997-126543019 CCCTTAGGAATTTCACTATTTAA No data
Right 979924438 4:126543050-126543072 CTGAGAATTAGGAGCTTACAGGG No data
979924431_979924437 29 Left 979924431 4:126542997-126543019 CCCTTAGGAATTTCACTATTTAA No data
Right 979924437 4:126543049-126543071 ACTGAGAATTAGGAGCTTACAGG No data
979924431_979924434 4 Left 979924431 4:126542997-126543019 CCCTTAGGAATTTCACTATTTAA No data
Right 979924434 4:126543024-126543046 GAGGTAGAGAAGAGCCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979924431 Original CRISPR TTAAATAGTGAAATTCCTAA GGG (reversed) Intergenic
No off target data available for this crispr