ID: 979924432

View in Genome Browser
Species Human (GRCh38)
Location 4:126542998-126543020
Sequence TTTAAATAGTGAAATTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979924432_979924438 29 Left 979924432 4:126542998-126543020 CCTTAGGAATTTCACTATTTAAA No data
Right 979924438 4:126543050-126543072 CTGAGAATTAGGAGCTTACAGGG No data
979924432_979924436 18 Left 979924432 4:126542998-126543020 CCTTAGGAATTTCACTATTTAAA No data
Right 979924436 4:126543039-126543061 CAACAAGGAAACTGAGAATTAGG No data
979924432_979924437 28 Left 979924432 4:126542998-126543020 CCTTAGGAATTTCACTATTTAAA No data
Right 979924437 4:126543049-126543071 ACTGAGAATTAGGAGCTTACAGG No data
979924432_979924434 3 Left 979924432 4:126542998-126543020 CCTTAGGAATTTCACTATTTAAA No data
Right 979924434 4:126543024-126543046 GAGGTAGAGAAGAGCCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979924432 Original CRISPR TTTAAATAGTGAAATTCCTA AGG (reversed) Intergenic
No off target data available for this crispr