ID: 979924436

View in Genome Browser
Species Human (GRCh38)
Location 4:126543039-126543061
Sequence CAACAAGGAAACTGAGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979924432_979924436 18 Left 979924432 4:126542998-126543020 CCTTAGGAATTTCACTATTTAAA No data
Right 979924436 4:126543039-126543061 CAACAAGGAAACTGAGAATTAGG No data
979924431_979924436 19 Left 979924431 4:126542997-126543019 CCCTTAGGAATTTCACTATTTAA No data
Right 979924436 4:126543039-126543061 CAACAAGGAAACTGAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979924436 Original CRISPR CAACAAGGAAACTGAGAATT AGG Intergenic
No off target data available for this crispr