ID: 979926510

View in Genome Browser
Species Human (GRCh38)
Location 4:126572662-126572684
Sequence AAAGCCTTTAAAGGTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979926505_979926510 23 Left 979926505 4:126572616-126572638 CCACCTCATTTTTAATACTCCAT No data
Right 979926510 4:126572662-126572684 AAAGCCTTTAAAGGTAAAGTGGG No data
979926507_979926510 4 Left 979926507 4:126572635-126572657 CCATTGTAAAAATGAAATATTAC No data
Right 979926510 4:126572662-126572684 AAAGCCTTTAAAGGTAAAGTGGG No data
979926504_979926510 24 Left 979926504 4:126572615-126572637 CCCACCTCATTTTTAATACTCCA No data
Right 979926510 4:126572662-126572684 AAAGCCTTTAAAGGTAAAGTGGG No data
979926506_979926510 20 Left 979926506 4:126572619-126572641 CCTCATTTTTAATACTCCATTGT No data
Right 979926510 4:126572662-126572684 AAAGCCTTTAAAGGTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979926510 Original CRISPR AAAGCCTTTAAAGGTAAAGT GGG Intergenic
No off target data available for this crispr