ID: 979927364

View in Genome Browser
Species Human (GRCh38)
Location 4:126583669-126583691
Sequence CTGGCTGAGCAGAAGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979927364_979927367 4 Left 979927364 4:126583669-126583691 CCCTTCTGCTTCTGCTCAGCCAG No data
Right 979927367 4:126583696-126583718 TACCCATAAGTGCCACCTATTGG No data
979927364_979927370 12 Left 979927364 4:126583669-126583691 CCCTTCTGCTTCTGCTCAGCCAG No data
Right 979927370 4:126583704-126583726 AGTGCCACCTATTGGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979927364 Original CRISPR CTGGCTGAGCAGAAGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr