ID: 979932068

View in Genome Browser
Species Human (GRCh38)
Location 4:126643210-126643232
Sequence ATGGAGGAGCAGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979932064_979932068 -8 Left 979932064 4:126643195-126643217 CCAAAAAAGGAAATAATGGAGGA No data
Right 979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979932068 Original CRISPR ATGGAGGAGCAGAGGGATGA GGG Intergenic
No off target data available for this crispr