ID: 979937356

View in Genome Browser
Species Human (GRCh38)
Location 4:126715040-126715062
Sequence CTGTTTTCTCAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979937356_979937359 -8 Left 979937356 4:126715040-126715062 CCTTCCTCATGCTGAGAAAACAG No data
Right 979937359 4:126715055-126715077 GAAAACAGGTCGCCCAAAAGAGG No data
979937356_979937364 7 Left 979937356 4:126715040-126715062 CCTTCCTCATGCTGAGAAAACAG No data
Right 979937364 4:126715070-126715092 AAAAGAGGGTCTCCGGTTTGCGG No data
979937356_979937361 0 Left 979937356 4:126715040-126715062 CCTTCCTCATGCTGAGAAAACAG No data
Right 979937361 4:126715063-126715085 GTCGCCCAAAAGAGGGTCTCCGG No data
979937356_979937360 -7 Left 979937356 4:126715040-126715062 CCTTCCTCATGCTGAGAAAACAG No data
Right 979937360 4:126715056-126715078 AAAACAGGTCGCCCAAAAGAGGG No data
979937356_979937366 21 Left 979937356 4:126715040-126715062 CCTTCCTCATGCTGAGAAAACAG No data
Right 979937366 4:126715084-126715106 GGTTTGCGGCCAAACGCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979937356 Original CRISPR CTGTTTTCTCAGCATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr