ID: 979942173

View in Genome Browser
Species Human (GRCh38)
Location 4:126775335-126775357
Sequence CAAAACACTGAAAGTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979942173_979942174 -8 Left 979942173 4:126775335-126775357 CCAATATCACTTTCAGTGTTTTG No data
Right 979942174 4:126775350-126775372 GTGTTTTGTTACCAAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979942173 Original CRISPR CAAAACACTGAAAGTGATAT TGG (reversed) Intergenic
No off target data available for this crispr