ID: 979942960

View in Genome Browser
Species Human (GRCh38)
Location 4:126785561-126785583
Sequence CACACTGGAAAAATTGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979942953_979942960 0 Left 979942953 4:126785538-126785560 CCAATCTTTTGGCCTCCCTAGGC No data
Right 979942960 4:126785561-126785583 CACACTGGAAAAATTGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979942960 Original CRISPR CACACTGGAAAAATTGTCAT GGG Intergenic
No off target data available for this crispr