ID: 979943012

View in Genome Browser
Species Human (GRCh38)
Location 4:126786586-126786608
Sequence CATATATGAGCTATGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979943010_979943012 9 Left 979943010 4:126786554-126786576 CCATATTGCTGACATTACTCTCT No data
Right 979943012 4:126786586-126786608 CATATATGAGCTATGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979943012 Original CRISPR CATATATGAGCTATGTCTTC AGG Intergenic
No off target data available for this crispr