ID: 979947402

View in Genome Browser
Species Human (GRCh38)
Location 4:126850454-126850476
Sequence AGTCATGAGCAGGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979947402_979947407 30 Left 979947402 4:126850454-126850476 CCTTCCACTTCCTGCTCATGACT No data
Right 979947407 4:126850507-126850529 CCCTAACCACAGAATCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979947402 Original CRISPR AGTCATGAGCAGGAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr