ID: 979947548

View in Genome Browser
Species Human (GRCh38)
Location 4:126852277-126852299
Sequence TCTCCTCAATTGAGTACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979947543_979947548 -2 Left 979947543 4:126852256-126852278 CCCAAAATTAAAACCAAAGTATC No data
Right 979947548 4:126852277-126852299 TCTCCTCAATTGAGTACTTGGGG No data
979947544_979947548 -3 Left 979947544 4:126852257-126852279 CCAAAATTAAAACCAAAGTATCT No data
Right 979947548 4:126852277-126852299 TCTCCTCAATTGAGTACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979947548 Original CRISPR TCTCCTCAATTGAGTACTTG GGG Intergenic
No off target data available for this crispr