ID: 979952172

View in Genome Browser
Species Human (GRCh38)
Location 4:126906771-126906793
Sequence GTGAGATTCTCCTAAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979952172_979952174 -2 Left 979952172 4:126906771-126906793 CCTGCACCTTAGGAGAATCTCAC No data
Right 979952174 4:126906792-126906814 ACTAATGCCTGATGATCTGATGG 0: 3
1: 13
2: 27
3: 32
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979952172 Original CRISPR GTGAGATTCTCCTAAGGTGC AGG (reversed) Intergenic
No off target data available for this crispr