ID: 979955370

View in Genome Browser
Species Human (GRCh38)
Location 4:126947652-126947674
Sequence CTAGATCAGCAGAAGTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979955370_979955373 -10 Left 979955370 4:126947652-126947674 CCTCTATACTTCTGCTGATCTAG No data
Right 979955373 4:126947665-126947687 GCTGATCTAGCAATGGGCTCAGG No data
979955370_979955374 18 Left 979955370 4:126947652-126947674 CCTCTATACTTCTGCTGATCTAG No data
Right 979955374 4:126947693-126947715 GACTGCCACAGTGCTCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979955370 Original CRISPR CTAGATCAGCAGAAGTATAG AGG (reversed) Intergenic
No off target data available for this crispr