ID: 979957132

View in Genome Browser
Species Human (GRCh38)
Location 4:126968086-126968108
Sequence ACATGGAACGTGAGTGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979957132_979957138 13 Left 979957132 4:126968086-126968108 CCCGTCTCACTCACGTTCCATGT No data
Right 979957138 4:126968122-126968144 AAACCCTAAAGTAAGTGACAGGG No data
979957132_979957137 12 Left 979957132 4:126968086-126968108 CCCGTCTCACTCACGTTCCATGT No data
Right 979957137 4:126968121-126968143 AAAACCCTAAAGTAAGTGACAGG No data
979957132_979957142 26 Left 979957132 4:126968086-126968108 CCCGTCTCACTCACGTTCCATGT No data
Right 979957142 4:126968135-126968157 AGTGACAGGGCTCCCAGGTTTGG No data
979957132_979957141 21 Left 979957132 4:126968086-126968108 CCCGTCTCACTCACGTTCCATGT No data
Right 979957141 4:126968130-126968152 AAGTAAGTGACAGGGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979957132 Original CRISPR ACATGGAACGTGAGTGAGAC GGG (reversed) Intergenic
No off target data available for this crispr