ID: 979966057

View in Genome Browser
Species Human (GRCh38)
Location 4:127077579-127077601
Sequence GGGAACTCCCTCCCCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979966057_979966061 -2 Left 979966057 4:127077579-127077601 CCTGGAGAGGGGAGGGAGTTCCC No data
Right 979966061 4:127077600-127077622 CCTGACCCCTTGTGCTTCCCGGG 0: 384
1: 1323
2: 1305
3: 1243
4: 1152
979966057_979966059 -3 Left 979966057 4:127077579-127077601 CCTGGAGAGGGGAGGGAGTTCCC No data
Right 979966059 4:127077599-127077621 CCCTGACCCCTTGTGCTTCCCGG 0: 356
1: 598
2: 969
3: 712
4: 789
979966057_979966065 8 Left 979966057 4:127077579-127077601 CCTGGAGAGGGGAGGGAGTTCCC No data
Right 979966065 4:127077610-127077632 TGTGCTTCCCGGGTGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979966057 Original CRISPR GGGAACTCCCTCCCCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr