ID: 979972541

View in Genome Browser
Species Human (GRCh38)
Location 4:127154806-127154828
Sequence CTGCACAGGAGGTGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979972530_979972541 13 Left 979972530 4:127154770-127154792 CCCCAACACAGTGTCCCCATTCT No data
Right 979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG No data
979972537_979972541 -3 Left 979972537 4:127154786-127154808 CCATTCTGTTAGGAACCAGGCTG No data
Right 979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG No data
979972535_979972541 -1 Left 979972535 4:127154784-127154806 CCCCATTCTGTTAGGAACCAGGC No data
Right 979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG No data
979972531_979972541 12 Left 979972531 4:127154771-127154793 CCCAACACAGTGTCCCCATTCTG No data
Right 979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG No data
979972536_979972541 -2 Left 979972536 4:127154785-127154807 CCCATTCTGTTAGGAACCAGGCT No data
Right 979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG No data
979972532_979972541 11 Left 979972532 4:127154772-127154794 CCAACACAGTGTCCCCATTCTGT No data
Right 979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979972541 Original CRISPR CTGCACAGGAGGTGAGCAGA AGG Intergenic
No off target data available for this crispr