ID: 979975982

View in Genome Browser
Species Human (GRCh38)
Location 4:127196851-127196873
Sequence ACACAGAGCCTTTGCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979975982_979975988 8 Left 979975982 4:127196851-127196873 CCATCCCAGCAAAGGCTCTGTGT No data
Right 979975988 4:127196882-127196904 AAGTGTTCCTGTTCTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979975982 Original CRISPR ACACAGAGCCTTTGCTGGGA TGG (reversed) Intergenic
No off target data available for this crispr