ID: 979977463

View in Genome Browser
Species Human (GRCh38)
Location 4:127214418-127214440
Sequence ATTCTAGACAATCATCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979977463_979977467 -8 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977467 4:127214433-127214455 TCTAGAATTCTGTGCCAGGCAGG No data
979977463_979977469 -4 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977469 4:127214437-127214459 GAATTCTGTGCCAGGCAGGAGGG No data
979977463_979977475 14 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977475 4:127214455-127214477 GAGGGTTAGGGAAAAAAGGAGGG No data
979977463_979977468 -5 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977468 4:127214436-127214458 AGAATTCTGTGCCAGGCAGGAGG No data
979977463_979977471 2 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977471 4:127214443-127214465 TGTGCCAGGCAGGAGGGTTAGGG No data
979977463_979977470 1 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977470 4:127214442-127214464 CTGTGCCAGGCAGGAGGGTTAGG No data
979977463_979977476 15 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977476 4:127214456-127214478 AGGGTTAGGGAAAAAAGGAGGGG No data
979977463_979977477 20 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG No data
979977463_979977474 13 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977474 4:127214454-127214476 GGAGGGTTAGGGAAAAAAGGAGG No data
979977463_979977473 10 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977473 4:127214451-127214473 GCAGGAGGGTTAGGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979977463 Original CRISPR ATTCTAGACAATCATCAGGG AGG (reversed) Intergenic
No off target data available for this crispr