ID: 979977464

View in Genome Browser
Species Human (GRCh38)
Location 4:127214421-127214443
Sequence AGAATTCTAGACAATCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979977464_979977468 -8 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977468 4:127214436-127214458 AGAATTCTGTGCCAGGCAGGAGG No data
979977464_979977473 7 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977473 4:127214451-127214473 GCAGGAGGGTTAGGGAAAAAAGG No data
979977464_979977469 -7 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977469 4:127214437-127214459 GAATTCTGTGCCAGGCAGGAGGG No data
979977464_979977475 11 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977475 4:127214455-127214477 GAGGGTTAGGGAAAAAAGGAGGG No data
979977464_979977476 12 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977476 4:127214456-127214478 AGGGTTAGGGAAAAAAGGAGGGG No data
979977464_979977474 10 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977474 4:127214454-127214476 GGAGGGTTAGGGAAAAAAGGAGG No data
979977464_979977471 -1 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977471 4:127214443-127214465 TGTGCCAGGCAGGAGGGTTAGGG No data
979977464_979977477 17 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG No data
979977464_979977470 -2 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977470 4:127214442-127214464 CTGTGCCAGGCAGGAGGGTTAGG No data
979977464_979977479 30 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977479 4:127214474-127214496 AGGGGCATGGAAAACTGCAAGGG No data
979977464_979977478 29 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977478 4:127214473-127214495 GAGGGGCATGGAAAACTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979977464 Original CRISPR AGAATTCTAGACAATCATCA GGG (reversed) Intergenic
No off target data available for this crispr