ID: 979977472

View in Genome Browser
Species Human (GRCh38)
Location 4:127214447-127214469
Sequence TTTTCCCTAACCCTCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979977472_979977483 26 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977483 4:127214496-127214518 GAAGAAAGGGAAGGAGAAAAAGG No data
979977472_979977477 -9 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG No data
979977472_979977482 17 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977482 4:127214487-127214509 ACTGCAAGGGAAGAAAGGGAAGG No data
979977472_979977484 27 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977484 4:127214497-127214519 AAGAAAGGGAAGGAGAAAAAGGG No data
979977472_979977478 3 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977478 4:127214473-127214495 GAGGGGCATGGAAAACTGCAAGG No data
979977472_979977479 4 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977479 4:127214474-127214496 AGGGGCATGGAAAACTGCAAGGG No data
979977472_979977481 13 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977481 4:127214483-127214505 GAAAACTGCAAGGGAAGAAAGGG No data
979977472_979977480 12 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977480 4:127214482-127214504 GGAAAACTGCAAGGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979977472 Original CRISPR TTTTCCCTAACCCTCCTGCC TGG (reversed) Intergenic
No off target data available for this crispr