ID: 979977477

View in Genome Browser
Species Human (GRCh38)
Location 4:127214461-127214483
Sequence TAGGGAAAAAAGGAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979977465_979977477 16 Left 979977465 4:127214422-127214444 CCTGATGATTGTCTAGAATTCTG No data
Right 979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG No data
979977463_979977477 20 Left 979977463 4:127214418-127214440 CCTCCCTGATGATTGTCTAGAAT No data
Right 979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG No data
979977464_979977477 17 Left 979977464 4:127214421-127214443 CCCTGATGATTGTCTAGAATTCT No data
Right 979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG No data
979977472_979977477 -9 Left 979977472 4:127214447-127214469 CCAGGCAGGAGGGTTAGGGAAAA No data
Right 979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979977477 Original CRISPR TAGGGAAAAAAGGAGGGGCA TGG Intergenic
No off target data available for this crispr