ID: 979981239

View in Genome Browser
Species Human (GRCh38)
Location 4:127257948-127257970
Sequence TCTTAAATGGAGATAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979981235_979981239 21 Left 979981235 4:127257904-127257926 CCATAATTCTAAAATTGCTTAAT No data
Right 979981239 4:127257948-127257970 TCTTAAATGGAGATAATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979981239 Original CRISPR TCTTAAATGGAGATAATGGG AGG Intergenic
No off target data available for this crispr