ID: 979991869

View in Genome Browser
Species Human (GRCh38)
Location 4:127384333-127384355
Sequence ATGTGTATGTATATGTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979991869_979991871 28 Left 979991869 4:127384333-127384355 CCTATATACATATACATACACAT No data
Right 979991871 4:127384384-127384406 TATCTAGAGAGAGGAAGAGAAGG No data
979991869_979991870 19 Left 979991869 4:127384333-127384355 CCTATATACATATACATACACAT No data
Right 979991870 4:127384375-127384397 GTGTGTGTGTATCTAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979991869 Original CRISPR ATGTGTATGTATATGTATAT AGG (reversed) Intergenic
No off target data available for this crispr