ID: 979994345

View in Genome Browser
Species Human (GRCh38)
Location 4:127412527-127412549
Sequence CCCTCTGTTCCTCTCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979994345_979994353 -7 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994353 4:127412543-127412565 CAGAGGGAGGTGGGGAAGGAGGG No data
979994345_979994358 27 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994358 4:127412577-127412599 AGAAAGAAAGGCAAGCATAGAGG No data
979994345_979994357 15 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994357 4:127412565-127412587 GAGGAGGGAGAAAGAAAGAAAGG No data
979994345_979994356 0 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG No data
979994345_979994354 -4 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994354 4:127412546-127412568 AGGGAGGTGGGGAAGGAGGGAGG No data
979994345_979994355 -1 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994355 4:127412549-127412571 GAGGTGGGGAAGGAGGGAGGAGG No data
979994345_979994352 -8 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994352 4:127412542-127412564 ACAGAGGGAGGTGGGGAAGGAGG No data
979994345_979994359 28 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994359 4:127412578-127412600 GAAAGAAAGGCAAGCATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979994345 Original CRISPR CCCTCTGTTCCTCTCTCCCT TGG (reversed) Intergenic
No off target data available for this crispr