ID: 979994356

View in Genome Browser
Species Human (GRCh38)
Location 4:127412550-127412572
Sequence AGGTGGGGAAGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979994345_979994356 0 Left 979994345 4:127412527-127412549 CCAAGGGAGAGAGGAACAGAGGG No data
Right 979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979994356 Original CRISPR AGGTGGGGAAGGAGGGAGGA GGG Intergenic
No off target data available for this crispr