ID: 979994901

View in Genome Browser
Species Human (GRCh38)
Location 4:127420121-127420143
Sequence CTGTCTGATGGGGTGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979994901_979994908 -7 Left 979994901 4:127420121-127420143 CCCTCTACCACCCCATCAGACAG No data
Right 979994908 4:127420137-127420159 CAGACAGCCTGTCCTTTCTTGGG No data
979994901_979994909 -6 Left 979994901 4:127420121-127420143 CCCTCTACCACCCCATCAGACAG No data
Right 979994909 4:127420138-127420160 AGACAGCCTGTCCTTTCTTGGGG No data
979994901_979994907 -8 Left 979994901 4:127420121-127420143 CCCTCTACCACCCCATCAGACAG No data
Right 979994907 4:127420136-127420158 TCAGACAGCCTGTCCTTTCTTGG No data
979994901_979994912 11 Left 979994901 4:127420121-127420143 CCCTCTACCACCCCATCAGACAG No data
Right 979994912 4:127420155-127420177 TTGGGGTCTCAGCATAGTAGTGG No data
979994901_979994913 24 Left 979994901 4:127420121-127420143 CCCTCTACCACCCCATCAGACAG No data
Right 979994913 4:127420168-127420190 ATAGTAGTGGACACATATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979994901 Original CRISPR CTGTCTGATGGGGTGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr