ID: 980000388

View in Genome Browser
Species Human (GRCh38)
Location 4:127480690-127480712
Sequence CTAGAGATCCAGATTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980000388_980000397 19 Left 980000388 4:127480690-127480712 CCTTCCCCAATCTGGATCTCTAG No data
Right 980000397 4:127480732-127480754 TCTTATGATTTGTCAGTTTGGGG No data
980000388_980000395 17 Left 980000388 4:127480690-127480712 CCTTCCCCAATCTGGATCTCTAG No data
Right 980000395 4:127480730-127480752 ACTCTTATGATTTGTCAGTTTGG No data
980000388_980000396 18 Left 980000388 4:127480690-127480712 CCTTCCCCAATCTGGATCTCTAG No data
Right 980000396 4:127480731-127480753 CTCTTATGATTTGTCAGTTTGGG No data
980000388_980000393 -8 Left 980000388 4:127480690-127480712 CCTTCCCCAATCTGGATCTCTAG No data
Right 980000393 4:127480705-127480727 ATCTCTAGAGAATGAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980000388 Original CRISPR CTAGAGATCCAGATTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr