ID: 980002263

View in Genome Browser
Species Human (GRCh38)
Location 4:127503708-127503730
Sequence GTGTTAAAACAGATAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980002263_980002265 -2 Left 980002263 4:127503708-127503730 CCTTCTTTTATCTGTTTTAACAC No data
Right 980002265 4:127503729-127503751 ACAGCTCAATATTATGGAATTGG No data
980002263_980002264 -8 Left 980002263 4:127503708-127503730 CCTTCTTTTATCTGTTTTAACAC No data
Right 980002264 4:127503723-127503745 TTTAACACAGCTCAATATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980002263 Original CRISPR GTGTTAAAACAGATAAAAGA AGG (reversed) Intergenic
No off target data available for this crispr