ID: 980007134

View in Genome Browser
Species Human (GRCh38)
Location 4:127555518-127555540
Sequence CTGTGGAAATGGAGAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980007129_980007134 17 Left 980007129 4:127555478-127555500 CCAGATAGGAAACTGAACAGGTG No data
Right 980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980007134 Original CRISPR CTGTGGAAATGGAGAGAAAT TGG Intergenic
No off target data available for this crispr