ID: 980013735

View in Genome Browser
Species Human (GRCh38)
Location 4:127623901-127623923
Sequence GCGCATGCGCGCGCGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980013735_980013741 29 Left 980013735 4:127623901-127623923 CCCCAACACGCGCGCGCATGCGC 0: 1
1: 0
2: 0
3: 12
4: 71
Right 980013741 4:127623953-127623975 AGAAATTTAAGAGTTTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980013735 Original CRISPR GCGCATGCGCGCGCGTGTTG GGG (reversed) Intronic
905375141 1:37514822-37514844 GCGCCTGCGCGCGCGGCTTCCGG + Intergenic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
911445485 1:97986811-97986833 GCGCACACGCGCGCGTCATGTGG - Intergenic
918048346 1:180954407-180954429 ACGCGTGCGCGCGTGTGCTGGGG - Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
1065483608 10:26216714-26216736 GCGCGTGCGTGCCCGTGTGGCGG - Exonic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1072276354 10:93827103-93827125 GTGCATGCGCGCATGTTTTGGGG + Intergenic
1077093862 11:791190-791212 GTGCATGCGTGTGTGTGTTGTGG - Exonic
1080231197 11:30018518-30018540 GCGCACGCGCTCGCGTGTGTGGG - Intergenic
1089424374 11:118359464-118359486 GCGCATGCGCTAGCTTGTTAGGG - Intergenic
1102551019 12:113692268-113692290 GCGCATGGGTGCGCATGCTGGGG - Intergenic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1146601966 17:34225229-34225251 GCGCGCGTGCGCGCGTGTTGGGG - Intergenic
1147257917 17:39193035-39193057 GCGCATGCCCGCGTGTGTGTTGG - Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152970622 18:158339-158361 GCGCAGGCGCGCACCTGCTGCGG + Intergenic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153943380 18:9996051-9996073 GTGCATGCACGTGTGTGTTGGGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1163126600 19:15247564-15247586 GCGCGTGCGTGCGTGTGTCGGGG + Intronic
1165154458 19:33778551-33778573 GCGCGTGTGCGTTCGTGTTGTGG - Intergenic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1168272680 19:55258590-55258612 GCGCAGGCGCCCGCGGGTCGTGG + Exonic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
927975963 2:27338431-27338453 GCGCGTGCGCGCCTGTGTAGAGG - Intronic
928093590 2:28391122-28391144 GCGCACGCGCGCGCGTCCTTGGG + Intergenic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
932231399 2:70087041-70087063 GCGCGTGCGCGAGGGTGTGGGGG - Intergenic
947958970 2:234218678-234218700 GCGCGTGTGCGCGCGTGTTTGGG + Intergenic
1168812017 20:710399-710421 GGGCGTGCGCGCGCGTGTCTGGG - Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
954299034 3:49689513-49689535 GCGCAAGCGTGCGCGTGATTTGG + Exonic
960047257 3:113210811-113210833 GCGCACGCGCGCGTGTGTGTTGG - Intergenic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
980013735 4:127623901-127623923 GCGCATGCGCGCGCGTGTTGGGG - Intronic
985751975 5:1685866-1685888 GTGCATGTGCGCGTGTGCTGAGG + Intergenic
987448442 5:18051469-18051491 GTGCATGCACGCGCGTGTCTTGG + Intergenic
997912448 5:137889425-137889447 GCGCTTGCGCGCTAGTCTTGCGG - Intronic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1003390594 6:5709698-5709720 GCGCATGCACGTGCATGTTGGGG + Intronic
1006204686 6:32330042-32330064 GCGCGCGCGCACGTGTGTTGGGG + Intronic
1007264663 6:40587446-40587468 GCGTATGCGCGCGCGCGTGGGGG - Exonic
1011729341 6:90244603-90244625 GCGCATGTGTGCGCGTGTGAAGG - Intronic
1012399523 6:98832711-98832733 GCGCGGGTGCGCGCGTGGTGGGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012912895 6:105137208-105137230 GCGCATGCGCGTGCGCGGTGCGG - Intergenic
1016308015 6:142703481-142703503 GTGCGTGCGCGCGCATGTTGCGG - Intergenic
1016823699 6:148368745-148368767 GCGCGTGCGCGCGCATGTGGGGG - Intronic
1019703302 7:2485140-2485162 GCGCGCGCGCGCGCGTGTGAGGG - Intergenic
1031001260 7:116417820-116417842 GTGCATGCACGCGTGTGTTTGGG - Intronic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1037769878 8:21792218-21792240 GCGCATGTGTGCGTGTGTTGGGG - Intronic
1041689909 8:60678740-60678762 GCGCAGGCGCTGGCGTGCTGGGG + Intergenic
1043464708 8:80493186-80493208 GCGCGCGCGCGCGCGTTTTGAGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1053137122 9:35658294-35658316 TCGCGTGCGCGTGCGCGTTGGGG + Exonic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059790036 9:117632133-117632155 GCGCGCGCGCGCGTGTATTGGGG - Intergenic
1059790038 9:117632135-117632157 GCGCGCGCGCGCGCGTGTATTGG - Intergenic
1062116618 9:134812806-134812828 GCGCATGCACACGCTTGTGGGGG + Intronic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1198177800 X:134172872-134172894 GCGCATGCGCGCGCCGGGTGGGG - Intergenic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic