ID: 980015462

View in Genome Browser
Species Human (GRCh38)
Location 4:127645431-127645453
Sequence AGTTACAGGCAGATGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980015462 Original CRISPR AGTTACAGGCAGATGGTGGT TGG (reversed) Intronic
900981267 1:6047584-6047606 AGTGCCAGGCAGCTGTTGGTGGG - Intronic
900981618 1:6049159-6049181 AGTGCCAGGCAGCTGTTGGTGGG - Intronic
902538850 1:17138250-17138272 AGTAAGAGACACATGGTGGTGGG - Intergenic
903016490 1:20365405-20365427 AGTGAGAGGCAGATGATGGCTGG - Intergenic
903491336 1:23731005-23731027 ATTTATAGGCAGAGGTTGGTGGG - Intergenic
904126950 1:28247623-28247645 AGTGACTGGCTGATAGTGGTGGG - Intergenic
904631772 1:31848130-31848152 AGTTAGAGGCAGGTGGAGGGTGG + Intergenic
904685493 1:32257209-32257231 ACTTACTGGCAGAAGGTTGTTGG - Intronic
905952195 1:41961239-41961261 AGTTACAGTCTGATGATGGTTGG - Intronic
906203080 1:43972240-43972262 ACTTCCAGGCAGGTGGGGGTCGG - Exonic
906576500 1:46895450-46895472 AGAGAAAGGCAGATGGGGGTGGG + Intergenic
906595418 1:47072135-47072157 AGAGAAAGGCAGATGGGGGTGGG - Intronic
907702712 1:56804907-56804929 AGTTAGAGGCAGGAAGTGGTGGG - Intronic
907952864 1:59200807-59200829 AGTTGCAGTCAGATGTTGGCTGG + Intergenic
908428919 1:64036845-64036867 GGTTGCAGTCAGATGGTGGCTGG + Intronic
908648218 1:66302893-66302915 AGTTACACACAGATAGAGGTTGG - Intronic
910890627 1:92015990-92016012 AGCTACTGGCAGTTGGTGGGCGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
913217784 1:116634985-116635007 GGTTACAGTCAGATGGTGGTTGG - Intronic
914249007 1:145906742-145906764 TGTTAGAGACAGATGGTGATGGG - Exonic
916227949 1:162508562-162508584 GATTACAGGCAGATGCTGCTAGG - Intronic
916336181 1:163673409-163673431 AGGTACAGGCAGATGGAGAAAGG - Intergenic
917336962 1:173934145-173934167 ACTTACATACAAATGGTGGTGGG - Exonic
920118319 1:203636963-203636985 AGTTCCCGGCAGGTGGAGGTGGG - Intronic
921857228 1:220000032-220000054 GGTTTCAGTCAGATGGTGGCTGG - Intronic
922240959 1:223755357-223755379 AGATAAAGGGAGATGGTGGGAGG - Intronic
1064162024 10:12954951-12954973 ATGGACAGGCAGATGGTGATGGG - Intronic
1067437898 10:46291833-46291855 AGTCCCAGGCAGATGGGGCTGGG + Intronic
1067764621 10:49075649-49075671 AGACACAGGCAGAGGCTGGTGGG + Intronic
1069586506 10:69607604-69607626 AGCTATAGGCAGGTGGTGGGGGG - Intergenic
1069753475 10:70759848-70759870 AGTTAGAAGCACCTGGTGGTAGG + Intronic
1070572178 10:77648572-77648594 ACTAACAGGCAGGTGGTGGGTGG + Intergenic
1070755282 10:78988154-78988176 TGTTACAGCCAGAAGGAGGTGGG + Intergenic
1070843406 10:79503567-79503589 AATTACAGGAAGATGGTGGGGGG + Intergenic
1070930259 10:80256034-80256056 AATTACAGGAAGATGGTGGGGGG - Intergenic
1072002339 10:91209021-91209043 ATTTATAGGCAGATTGTTGTTGG + Intronic
1074356590 10:112791042-112791064 AGTTACACCCTGATGGTGGAAGG - Intronic
1075695944 10:124435428-124435450 GGTCACAGACAGGTGGTGGTTGG - Intergenic
1076872967 10:133202583-133202605 AGCTCGAGGCAGACGGTGGTAGG - Intronic
1077212420 11:1377684-1377706 AGTTGCAAGCAGATGGGGGATGG + Intergenic
1077275658 11:1706299-1706321 AATCCCAGGCAGATGGGGGTGGG + Intergenic
1078126122 11:8565293-8565315 ACTTCCAGGGAGATGGGGGTTGG - Intronic
1078410154 11:11108005-11108027 GGATGCAGGCAGGTGGTGGTGGG + Intergenic
1078861591 11:15252932-15252954 GGACACAGGGAGATGGTGGTTGG - Intergenic
1079418382 11:20261993-20262015 AAAGACAGGGAGATGGTGGTCGG + Intergenic
1084584284 11:70047874-70047896 AGTTACAGGCAGTTTCTGGCTGG + Intergenic
1084875891 11:72133082-72133104 AGTCACAGGCAGAGGTTGTTGGG + Intronic
1085100852 11:73798545-73798567 AGTTACAGGGAGATGGGTTTGGG + Intronic
1085518304 11:77123901-77123923 GGGGACATGCAGATGGTGGTGGG - Exonic
1087135209 11:94709676-94709698 AGTTGCAGTCAGATAGTGGTGGG - Intronic
1087592475 11:100208655-100208677 AATTGTGGGCAGATGGTGGTAGG - Intronic
1088173295 11:107019860-107019882 AGTTAAAAGCAAATTGTGGTGGG - Intergenic
1088497857 11:110450012-110450034 AGTTACCAGCAGATGGGAGTGGG - Intronic
1088997562 11:115014913-115014935 AGTTACAGTCAGATGGCAGGGGG - Intergenic
1091479369 12:810879-810901 AGTTCCAGGCTGCTGGGGGTGGG - Intronic
1097018511 12:56004036-56004058 AGGTACAGGCAGATGGTTCCGGG - Exonic
1097680550 12:62645218-62645240 AGCCACAGGGAGATGGTGGTGGG - Exonic
1098696590 12:73565325-73565347 AGTTGCCAGGAGATGGTGGTGGG + Intergenic
1102775790 12:115517706-115517728 AATTACAGTCAGATGTTGTTGGG - Intergenic
1104206952 12:126648281-126648303 AGTTACAGGAAGTGGCTGGTTGG - Intergenic
1104411516 12:128562074-128562096 AGTTTGGGGTAGATGGTGGTGGG - Intronic
1109269205 13:60235583-60235605 AGTTGCAGTCAGATGGTGGCTGG - Intergenic
1111924174 13:94445505-94445527 AGCTGCAGTCAGATGGTGATAGG - Intronic
1112868487 13:103938532-103938554 GGATGCAGTCAGATGGTGGTTGG + Intergenic
1113374350 13:109750383-109750405 AGGCAGAGGCAGCTGGTGGTGGG + Intergenic
1113838162 13:113343221-113343243 AATTAGAGGCAGATGGAGTTAGG - Intronic
1114754154 14:25240090-25240112 AGTTGCAGTCATATGCTGGTTGG + Intergenic
1115074239 14:29366166-29366188 AGCTACAGGCACATGCTGCTGGG - Intergenic
1115793970 14:36911706-36911728 AGTTACAATCAGATAGTGGCTGG - Intronic
1117223369 14:53630351-53630373 AGTTACATGCAGGTGGTAGGAGG + Intergenic
1117278590 14:54214945-54214967 AACTACAGGCAGATTGTGTTTGG + Intergenic
1117861263 14:60094768-60094790 AGTTAAAGAAAGATGGGGGTGGG - Intronic
1118252189 14:64172321-64172343 AGTTGCAGTCAGATGGTGGCTGG + Intronic
1119025202 14:71147070-71147092 AGTTACTGGGTGGTGGTGGTGGG + Intergenic
1119639744 14:76305676-76305698 AGACACAGGCAGAGGGAGGTGGG - Intergenic
1119686847 14:76639907-76639929 AGTGAGAGCCAGATGTTGGTGGG - Intergenic
1120824958 14:88946572-88946594 AGTGACAGTCAGGTGGTGATGGG - Intergenic
1122003907 14:98686537-98686559 AGCTACAGGCTGATGGAGATTGG - Intergenic
1123685664 15:22795387-22795409 AGCTGCAAGCAGATGGTGGCTGG + Intronic
1127698526 15:61474712-61474734 GGTAAAAGGCAGAGGGTGGTAGG + Intergenic
1128211698 15:65907999-65908021 AGATACAGGGTGGTGGTGGTGGG + Intronic
1129176434 15:73843133-73843155 AGTTTCTGTCAGAGGGTGGTGGG - Intergenic
1129448018 15:75632429-75632451 AGGTACAGGCAGAGGGTGACTGG + Intergenic
1130151191 15:81313015-81313037 GGTAACAGGCAGATGGAGTTTGG + Exonic
1130399005 15:83531537-83531559 AGTGGCAGGCAGATCGTGGAAGG + Intronic
1130660028 15:85824063-85824085 AGAAACAGGCTGATGGAGGTTGG + Intergenic
1130925695 15:88384012-88384034 AGTTGAAGAAAGATGGTGGTGGG - Intergenic
1131666792 15:94579511-94579533 AGTGGCAGGCAGATGGAGGAAGG + Intergenic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1134282631 16:12831281-12831303 AGATTCAGGCAGATGGTAGGCGG - Intergenic
1134661886 16:15990481-15990503 AGTTGCAAGGAGCTGGTGGTGGG - Intronic
1134690888 16:16190521-16190543 AGGTACAGGATGATGGTGGTTGG - Intronic
1135219299 16:20599706-20599728 AATTTTTGGCAGATGGTGGTTGG - Intergenic
1135241912 16:20814781-20814803 AGTTCCAGGCAGACGGTGAATGG + Intronic
1135289578 16:21223820-21223842 AGTTACAGGCTGCTGGTGGATGG - Intergenic
1135343356 16:21667119-21667141 AGTTACAGGATGGTGATGGTGGG + Intergenic
1136113812 16:28081863-28081885 AGACAAAGGCAGGTGGTGGTGGG - Intergenic
1137574186 16:49587562-49587584 AGTTTCAGGCAGCTGGCTGTTGG + Intronic
1138577466 16:57917242-57917264 AGTCACAGGCAGGTGGTGTTGGG - Intronic
1139080681 16:63515657-63515679 AATTACAGTCAGATGGTGGTTGG + Intergenic
1141126312 16:81403614-81403636 AGTCACAGGGAGAAGGTGGCCGG - Intergenic
1141464106 16:84195502-84195524 AGCGACAGGCACAGGGTGGTTGG - Intronic
1142720365 17:1771738-1771760 AGTCACAGGAAGATGCTGGCTGG + Intronic
1142747994 17:1969905-1969927 GGTTGCAGTCAGATGGTGGCAGG + Intronic
1143903712 17:10193785-10193807 AGTTGCAATCAGATGGTGGCTGG - Intronic
1144389147 17:14777559-14777581 AGTAACAGGCAGCAGGGGGTGGG - Intergenic
1144930455 17:18854970-18854992 AGTTGCAGTCAGGTGGTGGCTGG + Intronic
1146623733 17:34420184-34420206 TGTTACAATCAGATGGGGGTAGG - Intergenic
1146726973 17:35164338-35164360 AGTTACAGTCATATGCTGGCTGG + Intronic
1151421316 17:73999939-73999961 ATTTCCAGGTAGATGGTGTTGGG - Intergenic
1152336407 17:79701847-79701869 AGGTGCAGGGAGATGGTGCTGGG + Intergenic
1152388924 17:79991684-79991706 AGCCACAGGCAGGTGGGGGTGGG + Intronic
1152454454 17:80405413-80405435 TTCTGCAGGCAGATGGTGGTTGG - Intergenic
1155136492 18:22999313-22999335 AGTTGTAGGCAGATGGTGGCTGG + Intronic
1155491562 18:26406045-26406067 AGTTAGAGGCAGAGGGTTGGAGG - Intergenic
1155680593 18:28481521-28481543 AGTTACAGGCACAAGGTTGGGGG + Intergenic
1156762507 18:40610384-40610406 AGTTACAGCAAGAGGGTGGGAGG - Intergenic
1158992291 18:62881835-62881857 AGTTACAGGCCAATGGAGTTTGG + Intronic
1162390983 19:10390133-10390155 GGCAACAGGCAGATGGTGCTGGG + Intergenic
1162713396 19:12612916-12612938 AGCCACAGGCAGATGCTGTTAGG + Intronic
1163884085 19:19950664-19950686 AGTTACAGGCAGAGGGAAGGAGG - Intergenic
1165868272 19:38952431-38952453 AGTTAGAGCAAGAAGGTGGTAGG - Intronic
1168640715 19:58029537-58029559 AGTTCCAGGCGGAGGGTGGAGGG + Intergenic
925258752 2:2511693-2511715 AGCAAAAGGCAGATGGAGGTTGG - Intergenic
927750486 2:25665283-25665305 ACTGACAGGGAGATGGTGGGAGG - Intronic
928585222 2:32753058-32753080 AGTTGCAATCAGATGGTGCTGGG + Intronic
928811081 2:35227221-35227243 AGTTAGAGGCAAATGAAGGTAGG - Intergenic
929532566 2:42762036-42762058 AGTATCAGGCAGAGGGAGGTGGG - Intergenic
931365815 2:61617889-61617911 AGTTAGAGAAAGAAGGTGGTTGG - Intergenic
931750585 2:65326533-65326555 AGTTTGAGGCAGCTGCTGGTGGG + Intronic
932429879 2:71667842-71667864 AGTCACTGACAGATAGTGGTTGG - Intronic
932803915 2:74766934-74766956 AGTTGCAGTCAGGTGGTGGCTGG - Intergenic
932931335 2:76043153-76043175 ACTTGTAGGCAGATGGTGATGGG + Intergenic
933407480 2:81879706-81879728 AGATACAGGTCGATGGTGGTGGG + Intergenic
934707059 2:96489466-96489488 GGTTACTAGGAGATGGTGGTGGG - Intergenic
935128501 2:100244084-100244106 AGTTACAGTCAGAGAGTGGCTGG + Intergenic
935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG + Intergenic
938874530 2:135518712-135518734 AGTTACAGGACTATGGTGGCTGG - Intronic
940186716 2:150993220-150993242 AGTTAATGGTAGAGGGTGGTGGG - Intergenic
941536905 2:166734870-166734892 AGTTATCTGCAGATTGTGGTAGG - Intergenic
941949696 2:171141393-171141415 AGTTACATGCAGCTAGTGGCTGG + Intronic
942528322 2:176880343-176880365 AGTTATAGCCAGATGTTGGTAGG - Intergenic
943563913 2:189495419-189495441 AGTAACAGGCAGAGGTTGGAAGG + Intergenic
945262449 2:207856478-207856500 AGTTACAGGGATTTGGTGGCTGG - Intronic
946452923 2:219796381-219796403 AGTTGCAGTCAGATGGTAGCTGG - Intergenic
947452280 2:230219945-230219967 AGTTACAGGGAGATGCTAGCAGG + Exonic
949021128 2:241742061-241742083 AGATGCAGGCAGAGGGTGGAAGG + Intronic
1169479163 20:5962047-5962069 AGTTGTAGTCAGATGGTGGCTGG + Intronic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1171279251 20:23882274-23882296 CATAACAGGCATATGGTGGTGGG + Intergenic
1173053492 20:39588565-39588587 AGTAACAGGGAGAGGGTGCTGGG + Intergenic
1173640429 20:44598051-44598073 AGTTGCAGTTAGATGGTGGCTGG + Intronic
1174094328 20:48075967-48075989 AGTTCCTGGCAGATGGCTGTGGG + Intergenic
1176410186 21:6445619-6445641 AGTCAGCGGCAGATGGTGTTCGG - Intergenic
1177355765 21:20004775-20004797 ACTTACAGGCAGTGGGTGCTTGG - Intergenic
1179685679 21:43053941-43053963 AGTCAGCGGCAGATGGTGTTCGG - Exonic
1179718402 21:43301874-43301896 AATCACAGGGAGATGGTGGCTGG + Intergenic
1180282368 22:10714253-10714275 AGTTGAAGGATGATGGTGGTTGG + Intergenic
1182043975 22:27259981-27260003 AGTTGCAGGCAGGAGGTGATAGG + Intergenic
1184524121 22:45011581-45011603 AGATTCAGGCAGATGCTGGCCGG - Intergenic
1184737531 22:46408322-46408344 AGCCACAGCCAGGTGGTGGTTGG - Intronic
1185048235 22:48539896-48539918 GGGTACAGGCAGAAGGTGGGAGG + Intronic
949167477 3:959591-959613 AGTTAAAGGCAGATACTTGTAGG + Intergenic
949639424 3:6018637-6018659 AGAAAAAGGCAGAGGGTGGTGGG + Intergenic
950404776 3:12797429-12797451 AGTCACAGGTAGGTGATGGTTGG + Intronic
951453199 3:22862643-22862665 AGTTCCAGTCAGAAGGTGGCAGG + Intergenic
951947380 3:28155544-28155566 GGTTCCAGACAGATGGTGGAAGG - Intergenic
952189203 3:31004497-31004519 AGTTGCAGGCAGACAGTGGCTGG + Intergenic
952259673 3:31727791-31727813 AGGTATAGGTAGATGTTGGTTGG - Intronic
953213917 3:40900056-40900078 AGTTGCAGTCAGATGGTAGATGG + Intergenic
954807593 3:53229467-53229489 AGGGGCAGGCAGAGGGTGGTCGG + Intronic
955142680 3:56285208-56285230 AGTTTCAAGCAGATGGGGCTAGG + Intronic
957110292 3:75946968-75946990 AGTTGAAGGATGATGGTGGTTGG + Intronic
959856347 3:111163059-111163081 AGTTACAGTCAGATGGTGGCTGG + Intronic
960616835 3:119603601-119603623 ACTTACATGCAAATGTTGGTGGG - Intronic
960906536 3:122607300-122607322 AGTTATAGGCATAGTGTGGTGGG + Intronic
961554033 3:127685437-127685459 AGTTCCAGGCAGAATTTGGTTGG + Intergenic
962025461 3:131542642-131542664 AGTGACATGCAGATGCTGGACGG - Exonic
963554295 3:146768390-146768412 TGTTACAGGAAGACAGTGGTGGG - Intergenic
964311608 3:155399737-155399759 AGTTGCAGCCAGATGATGGCTGG + Intronic
964383077 3:156118209-156118231 AGTTGCAGTCAGATGTTGGCTGG + Intronic
964638023 3:158878661-158878683 ACTTGCAGTCAGATTGTGGTTGG + Intergenic
965795880 3:172438209-172438231 AGTTTCAGGGAGGTGGTAGTGGG - Intergenic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
967931112 3:194690906-194690928 ACTGACAGGCATGTGGTGGTTGG + Intergenic
969528003 4:7713836-7713858 TGTTGCAGGGAGATGGGGGTAGG + Intronic
970741888 4:19249437-19249459 AGGTACAGGCAGATGCTGCAGGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
973265725 4:48208422-48208444 AGTAACAGGCAGATTTTGGAGGG - Intronic
973601829 4:52549819-52549841 AGTAACAGGGAGTTGGGGGTGGG - Intergenic
975887884 4:78986890-78986912 AGTTTCATGCAGTTGATGGTTGG + Intergenic
976060685 4:81124720-81124742 AGTTACAGTCAGATGGTGTCGGG - Intronic
976264271 4:83175314-83175336 TGTCTCAGGCAGGTGGTGGTTGG - Intergenic
976772975 4:88674230-88674252 GGTTACAGGAAGAGGGTGGGGGG + Intronic
978243466 4:106544322-106544344 AGTAGCAGTCAGATGGTGGCAGG - Intergenic
980015462 4:127645431-127645453 AGTTACAGGCAGATGGTGGTTGG - Intronic
980209660 4:129771263-129771285 AGTTACAGTCAAATGCTGGCTGG + Intergenic
980670882 4:136005320-136005342 AGTTACTGCCAGATGTTGATTGG - Intergenic
981055710 4:140359193-140359215 AGCTACAGTCAGATGTGGGTGGG + Intronic
983117652 4:163838665-163838687 AGTTAGTGGCAGATGTTGCTAGG + Intronic
983643183 4:169962875-169962897 AATTTCAGGCAGATGGTGATGGG - Intergenic
985125900 4:186694013-186694035 AGAAATAGGAAGATGGTGGTTGG - Intronic
985125916 4:186694152-186694174 AGAAATAGGAAGATGGTGGTTGG - Intronic
985745933 5:1647755-1647777 AGTGACAGGGAGATGCTGGTGGG - Intergenic
985871746 5:2562887-2562909 AGGCACAGGCAGATGCTGGCAGG - Intergenic
986342289 5:6801070-6801092 AGTAAGAGGGAGATGATGGTTGG - Intergenic
988277102 5:29095780-29095802 AGTTGCAGTCAAATGGTAGTTGG + Intergenic
988453950 5:31371027-31371049 AATGACAAGCAGTTGGTGGTTGG - Intergenic
990335626 5:54769539-54769561 AGTTGCCAGCAGATTGTGGTAGG + Intergenic
990525121 5:56617837-56617859 AGTTGCAGGCAGGTGTTGGCTGG - Intergenic
992198971 5:74365816-74365838 AGTTGAAGTCAGTTGGTGGTGGG + Intergenic
994007293 5:94853953-94853975 AGACACAGGCAGATGGTGGCAGG + Intronic
995741056 5:115356108-115356130 AGTTGCAGTCACATGGTGGGTGG - Intergenic
998148731 5:139745325-139745347 TGCCACAGGCAGATGGTGGAGGG + Intergenic
999438225 5:151581025-151581047 AGTTACAGGCAGAACCTGGTTGG - Intergenic
999567714 5:152884066-152884088 AGTTAGAGGGAGAGTGTGGTAGG - Intergenic
999605841 5:153314997-153315019 AGGTACAGGCAGGTGGAAGTGGG - Intergenic
999664825 5:153901749-153901771 GGTTGCAGTCAGATGGTGGCTGG - Intergenic
1001422773 5:171599977-171599999 AGTGACAGACAGAAGATGGTGGG + Intergenic
1001757448 5:174181353-174181375 AGTTACAGGCAGATGCTTCAAGG + Intronic
1001878137 5:175218542-175218564 AGCTGCAGTCAGATGGTGCTGGG + Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1003577904 6:7314520-7314542 AGTCACAGCCTGATGGTGCTGGG + Intronic
1003621226 6:7702341-7702363 GGATACATGGAGATGGTGGTAGG + Intergenic
1003903274 6:10675175-10675197 AGTTGCAGGGAGAGAGTGGTAGG - Intronic
1004983312 6:21050842-21050864 AGTGACAGGCAGATAGGGGCAGG - Intronic
1008673757 6:53797844-53797866 AGTTAGATGCAGTTGCTGGTGGG + Intronic
1014276062 6:119390652-119390674 AGTTGCAGTCAGATGGTAGTTGG - Intergenic
1015136122 6:129873094-129873116 AGTTACAGTCAGATTTTGATTGG + Intergenic
1017802700 6:157911983-157912005 AGTGACAGCCAGATGGCCGTGGG + Intronic
1017984526 6:159432064-159432086 ATTTGCAGTCAGATGGTGGTTGG + Intergenic
1018633696 6:165842482-165842504 AGTTACAGTCAGTGGGTGCTGGG - Intronic
1021619725 7:22539551-22539573 AGTAAGAGTCAGAGGGTGGTGGG - Intronic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1022911379 7:34902153-34902175 AGTTACAGGCAGAGTGGGGGTGG - Intergenic
1023760477 7:43461192-43461214 AGTTGCAGTCAGAGGGTGGCCGG + Intronic
1024098324 7:46004225-46004247 TGTGCCAGGCACATGGTGGTAGG + Intergenic
1028137220 7:87234740-87234762 AGTTACTGGCAGTTGGAGGGTGG - Intergenic
1028371541 7:90098048-90098070 AGTAAGAGTCAGAGGGTGGTGGG + Intergenic
1028889325 7:95969364-95969386 AGTTAGGGTCAGATGGTAGTGGG + Intronic
1030176721 7:106661279-106661301 AGTTCCTGGAAGATGGTGCTGGG + Intergenic
1031757096 7:125658740-125658762 AGGGACAGGGAGATGGGGGTTGG - Intergenic
1031885767 7:127244654-127244676 AAATACAAGCAGATGTTGGTTGG - Intronic
1032416730 7:131741109-131741131 TGTTCCAGGGATATGGTGGTGGG + Intergenic
1033322125 7:140349451-140349473 AGCTGCATGAAGATGGTGGTGGG + Intronic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1037719267 8:21429182-21429204 GGTTGCAGGCAGGGGGTGGTTGG - Intergenic
1039615512 8:38952085-38952107 AGATTCAGGCAGAGGGAGGTAGG + Intronic
1040531175 8:48267499-48267521 GGTTACAGAGAGATGGAGGTGGG + Intergenic
1042220866 8:66472478-66472500 AATTACTGGCAGCTGGGGGTGGG + Intronic
1044486505 8:92760866-92760888 AGTTGCAGTCAGATGGTGATTGG + Intergenic
1047484328 8:125315167-125315189 AGTTACAGGGATAGAGTGGTAGG + Intronic
1048610369 8:136015724-136015746 AGTTACAGGGAGATTTTTGTTGG - Intergenic
1050061271 9:1712080-1712102 GGTTACAGGCAGATGGAAGCAGG + Intergenic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1057727348 9:97577290-97577312 AACTACACGCAGATGGTGTTTGG - Intronic
1058450174 9:105089166-105089188 AGTTGCAGTTAGATGGTGGCTGG - Intergenic
1059077548 9:111210122-111210144 AATAACAGGCAGAAGGTTGTGGG + Intergenic
1061243159 9:129386131-129386153 AGTCAAAGGCAGATGGGGCTAGG + Intergenic
1185718430 X:2362447-2362469 AATTAGTGGCATATGGTGGTGGG - Intronic
1185775660 X:2801052-2801074 AGTTCCAGAAAGATGGTGGAAGG - Intronic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1187724250 X:22186074-22186096 AGTTACAGTCAGATAGTGGCTGG + Intronic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1188963982 X:36527958-36527980 AATTAGAGGCAGATTGTGCTTGG + Intergenic
1189463129 X:41258550-41258572 ACTTCCAGTCTGATGGTGGTGGG - Intergenic
1189643928 X:43105808-43105830 AGTTACAGTCAGATAGTTGCTGG + Intergenic
1189815121 X:44817078-44817100 GGTTGCAGTCAGATGGTGGCAGG + Intergenic
1192179641 X:68908465-68908487 AAGTCCAGGCAGATGGTGGTGGG + Intergenic
1194053641 X:89103820-89103842 TGTTACATGCTGATGATGGTGGG + Intergenic
1194371465 X:93078382-93078404 AGATACAGCCAGTTGGTGGGAGG - Intergenic
1195731684 X:107974692-107974714 AGTCACAGGGAGATGGTGACAGG + Intergenic
1200088082 X:153620108-153620130 AGAACCATGCAGATGGTGGTGGG - Intergenic
1200679263 Y:6190260-6190282 AGATACAGCCAGTTGGTGGGAGG - Intergenic
1201294266 Y:12450305-12450327 AGTTACAGAAAGATGGTGGAAGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic