ID: 980019447

View in Genome Browser
Species Human (GRCh38)
Location 4:127691014-127691036
Sequence CCTCCCTTTCCATTAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980019442_980019447 -4 Left 980019442 4:127690995-127691017 CCTATCCCTCTCTTTCATCCCTC 0: 1
1: 0
2: 3
3: 105
4: 1001
Right 980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG No data
980019441_980019447 9 Left 980019441 4:127690982-127691004 CCTCTGTGTTCTGCCTATCCCTC 0: 1
1: 0
2: 30
3: 173
4: 731
Right 980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG No data
980019438_980019447 19 Left 980019438 4:127690972-127690994 CCCCAGAAATCCTCTGTGTTCTG 0: 1
1: 3
2: 41
3: 252
4: 693
Right 980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG No data
980019443_980019447 -9 Left 980019443 4:127691000-127691022 CCCTCTCTTTCATCCCTCCCTTT 0: 2
1: 1
2: 24
3: 251
4: 2227
Right 980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG No data
980019439_980019447 18 Left 980019439 4:127690973-127690995 CCCAGAAATCCTCTGTGTTCTGC 0: 2
1: 29
2: 174
3: 406
4: 856
Right 980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG No data
980019444_980019447 -10 Left 980019444 4:127691001-127691023 CCTCTCTTTCATCCCTCCCTTTC 0: 1
1: 0
2: 32
3: 294
4: 2581
Right 980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG No data
980019440_980019447 17 Left 980019440 4:127690974-127690996 CCAGAAATCCTCTGTGTTCTGCC 0: 1
1: 3
2: 29
3: 63
4: 321
Right 980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980019447 Original CRISPR CCTCCCTTTCCATTAACCCC TGG Intronic
No off target data available for this crispr