ID: 980020439

View in Genome Browser
Species Human (GRCh38)
Location 4:127703144-127703166
Sequence TGAACTGCCTGTACAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980020439 Original CRISPR TGAACTGCCTGTACAATAGC AGG (reversed) Intronic
901159975 1:7168698-7168720 AGAACTTCCAGTACAATTGCTGG - Intronic
901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG + Intronic
901677400 1:10893965-10893987 TAAACTGCCTGTATAGTACCTGG + Intergenic
907158740 1:52356415-52356437 TGAACTGCTTGGAGAACAGCAGG + Exonic
908485575 1:64589160-64589182 AGAGCTCCCTGTAAAATAGCAGG - Intronic
918997585 1:191781999-191782021 TTAACTGCCTGTACAACAATAGG + Intergenic
923166328 1:231366977-231366999 TGGACTGCCTCTCCAAGAGCAGG - Intronic
1063074682 10:2702646-2702668 TGGACTGCATGGACAACAGCTGG + Intergenic
1063884667 10:10565197-10565219 TGAAGTCCCTGTACACTGGCTGG + Intergenic
1063953859 10:11247872-11247894 TGAGCTGCCTCTTCAAAAGCAGG - Intronic
1075937205 10:126352555-126352577 TGAACTGCTTGGACCACAGCTGG + Intronic
1076239405 10:128892636-128892658 TGAGCTGCCCGTACAAGGGCTGG + Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1079038629 11:17042221-17042243 TGTACTGCCTGTGCGATATCGGG + Intergenic
1079764614 11:24375843-24375865 TTCACTGCCTAAACAATAGCTGG - Intergenic
1087652286 11:100881867-100881889 TCAACTCCTTTTACAATAGCTGG - Intronic
1091232552 11:133998185-133998207 AGAACTGCCTGGCCCATAGCAGG + Intergenic
1097184755 12:57190624-57190646 TGAACTGTCTGTGCAATAGTGGG + Intronic
1100426219 12:94489357-94489379 TGAAATGCATGTGCAATATCTGG - Intergenic
1100596812 12:96078826-96078848 TTAACTCCCTTTAGAATAGCTGG + Intergenic
1102497297 12:113328594-113328616 GGAACAGCATGTACAAAAGCTGG - Intronic
1110831593 13:80037911-80037933 TGACTTGCCTGTAGAAAAGCTGG + Intergenic
1115350294 14:32387047-32387069 TCAACTCCTTTTACAATAGCTGG - Intronic
1118237713 14:64024737-64024759 TTAACAGCCTGTATGATAGCGGG - Intronic
1130737941 15:86570273-86570295 TCAAGAGCCTGGACAATAGCTGG - Intronic
1135412743 16:22247476-22247498 TGAATTTTCTGTGCAATAGCTGG + Intronic
1139503197 16:67385297-67385319 TGCAATGTCTATACAATAGCTGG - Intergenic
1140337685 16:74124787-74124809 TTAGCTGTCTGTACAATAACTGG + Intergenic
1141217115 16:82035044-82035066 TGAACTGCATGGAGAATAACAGG - Intronic
1141811297 16:86378120-86378142 AGAACTGGCTGTAGAATTGCAGG - Intergenic
1146935725 17:36811520-36811542 TGACCTGCATGTTAAATAGCAGG - Intergenic
1148856587 17:50582313-50582335 TGAACTGCCTGGACCACTGCCGG - Intronic
1152846506 17:82603120-82603142 TGAAATGACTGCACACTAGCTGG + Exonic
1154380153 18:13842353-13842375 AGAACTGCCTCTAGAAAAGCAGG + Intergenic
1157628828 18:49076030-49076052 TATACTGCCTGTACAGTAACAGG - Intronic
1158451389 18:57569007-57569029 TAAACTGCCTGAACCAGAGCAGG + Intronic
1160050098 18:75425397-75425419 TCCACTGCCTGGACAATAGCAGG + Intronic
1163249441 19:16117774-16117796 TGAATAGCATGTACAAAAGCTGG + Intronic
940126827 2:150335375-150335397 TGATATGCCTGTACACAAGCTGG - Intergenic
941255367 2:163223265-163223287 TAAACTGCCTGTTCAATTACTGG - Intergenic
941587665 2:167380318-167380340 TGAGCTGCCTGTGCCATCGCTGG - Intergenic
942000207 2:171638905-171638927 TGATCTGACTGGATAATAGCTGG - Intergenic
945648168 2:212527581-212527603 TGAAGTACCAGTACAATAGAGGG - Intronic
948508984 2:238450577-238450599 TGAACAGCCTGTACGCTGGCAGG + Exonic
1169433328 20:5559703-5559725 TGACCTGCCTGTAAAATAAAGGG + Intronic
1173887043 20:46468910-46468932 TGAAATTCCTGTACTATAGGTGG + Intergenic
1175321361 20:58090531-58090553 TGAACTGGATGTATAATAGTGGG - Intergenic
1179176148 21:39009729-39009751 CCCACTGCCTGTACAAAAGCAGG - Intergenic
1183951432 22:41355150-41355172 GGAACAGCCTGTACAAACGCAGG + Intronic
949274966 3:2269052-2269074 TGCACTGCCTGTAAAAGAGATGG + Intronic
952385558 3:32839169-32839191 TGAATGGCATGTATAATAGCTGG - Intronic
952994978 3:38871078-38871100 TGCACTGCCTGTTCAAGACCTGG + Intronic
954993168 3:54858493-54858515 TTAACTGCCCAGACAATAGCAGG + Intronic
958021381 3:88001159-88001181 TAAACTGACTGTAGAATAACTGG + Intergenic
959626786 3:108461704-108461726 TGTACTGCCTGAAGATTAGCCGG + Intronic
962697316 3:137962957-137962979 AGCACTTCCTCTACAATAGCAGG + Intergenic
966807126 3:183816466-183816488 TGAACTGCCTCTTCAAAAGGTGG + Exonic
968130247 3:196188924-196188946 TCAACTGCCTGCACACAAGCAGG + Intergenic
968353885 3:198085380-198085402 TGAACAGTCTGTTCAACAGCTGG + Intergenic
978372194 4:108040085-108040107 TGAAGTGGCTGTTCAAGAGCAGG - Intergenic
980020439 4:127703144-127703166 TGAACTGCCTGTACAATAGCAGG - Intronic
983165758 4:164475757-164475779 AGAACTGCCTTTACAATTTCTGG + Intergenic
985114375 4:186576485-186576507 AGAACTCCCTGTACAGTACCCGG + Intergenic
986650938 5:9962691-9962713 TGCCCTGCCTGTAGAATAGGTGG + Intergenic
987525927 5:19049689-19049711 TGACCTTGCTGTACAAAAGCAGG - Intergenic
987922279 5:24298355-24298377 CCAACTGTCTGTACAATAGACGG - Intergenic
988838697 5:35061461-35061483 TTTACTGCCTGTACAAGATCTGG - Exonic
990991557 5:61689317-61689339 TGAAGTGCCTGACCATTAGCGGG + Intronic
994244140 5:97459430-97459452 TGTAATGCCTGCACAATACCTGG - Intergenic
998534158 5:142913988-142914010 TGAGCTGCCTGTTCAAGATCAGG + Intronic
1000371236 5:160538637-160538659 TAAAATGCATGTATAATAGCAGG + Intergenic
1005342701 6:24858250-24858272 TCAAGTGCCTGGCCAATAGCAGG + Intronic
1008699751 6:54084764-54084786 TAAAATGCCTTTACAATAACAGG - Intronic
1012888948 6:104877355-104877377 TCAAATGCCTGTGCAACAGCAGG + Intergenic
1018238695 6:161751898-161751920 TGAACTGGCTGGAGAAGAGCAGG + Intronic
1021185183 7:17555802-17555824 TAAACTGCCTGTGCCATATCTGG + Intergenic
1022218849 7:28292049-28292071 TGAACTGCCTGTGGGATAGAAGG + Intergenic
1022312698 7:29212142-29212164 TGAGTTGCCTCCACAATAGCAGG - Intronic
1027625333 7:80537549-80537571 TGAACTGTCTGAACAAAAGCAGG - Intronic
1030206927 7:106960123-106960145 TGAACAGCCAGTACAAAGGCTGG - Intergenic
1030680525 7:112429036-112429058 TGACCTGTCTGTCCAAAAGCAGG + Intronic
1032068501 7:128790552-128790574 AGAACTGCCTCTTCAAGAGCCGG + Intergenic
1039772148 8:40698327-40698349 TGACCTGCGAGCACAATAGCAGG - Intronic
1044538818 8:93387279-93387301 TGATGTGCCTATACAATACCAGG + Intergenic
1052332327 9:27282420-27282442 TGAACTGGCAGTACAAATGCTGG + Intergenic
1053264732 9:36703023-36703045 TGAAATGACTGTGTAATAGCTGG - Intergenic
1054862680 9:69969645-69969667 AGAACAGCCTGCCCAATAGCTGG + Intergenic
1055207981 9:73756322-73756344 TGAGTTGGCTGTACAGTAGCTGG + Intergenic
1187338082 X:18398106-18398128 TTAACTACCTGCACAATAGTTGG - Intergenic
1190708203 X:53048283-53048305 TGTGCTGCCAGGACAATAGCTGG - Intergenic
1192850086 X:74945982-74946004 TGAAGTGCCTATAGAATAGCTGG - Intergenic
1194882230 X:99268103-99268125 TGAACCCCTTTTACAATAGCTGG - Intergenic
1197134868 X:123049316-123049338 TGAAATGCCTGAAGATTAGCAGG - Intergenic
1197456788 X:126686327-126686349 TTAACTGCCTGTACAAAATGAGG + Intergenic