ID: 980023850

View in Genome Browser
Species Human (GRCh38)
Location 4:127740845-127740867
Sequence ATCTCTGCACAGAAAGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 14, 2: 63, 3: 130, 4: 328}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980023839_980023850 26 Left 980023839 4:127740796-127740818 CCTGGAGATCTGCCTGTGTATAA 0: 1
1: 1
2: 11
3: 67
4: 336
Right 980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG 0: 1
1: 14
2: 63
3: 130
4: 328
980023844_980023850 -9 Left 980023844 4:127740831-127740853 CCCACTGCACCACAATCTCTGCA 0: 5
1: 23
2: 37
3: 135
4: 456
Right 980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG 0: 1
1: 14
2: 63
3: 130
4: 328
980023845_980023850 -10 Left 980023845 4:127740832-127740854 CCACTGCACCACAATCTCTGCAC 0: 5
1: 25
2: 52
3: 129
4: 411
Right 980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG 0: 1
1: 14
2: 63
3: 130
4: 328
980023843_980023850 -8 Left 980023843 4:127740830-127740852 CCCCACTGCACCACAATCTCTGC 0: 4
1: 16
2: 37
3: 123
4: 481
Right 980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG 0: 1
1: 14
2: 63
3: 130
4: 328
980023842_980023850 14 Left 980023842 4:127740808-127740830 CCTGTGTATAAAGCAGAGAGGGC 0: 1
1: 1
2: 7
3: 46
4: 216
Right 980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG 0: 1
1: 14
2: 63
3: 130
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980023850 Original CRISPR ATCTCTGCACAGAAAGGGTA GGG Intronic
900037725 1:431362-431384 ATCTCAGCACAGGAAGGTTGGGG - Intergenic
900059355 1:667105-667127 ATCTCAGCACAGGAAGGTTGGGG - Intergenic
900744089 1:4349234-4349256 ATTTCTGAGCAGAAAGGGAAAGG + Intergenic
905027403 1:34860162-34860184 ACCTCTACACAGAAGGGGAAGGG - Intergenic
907173509 1:52495343-52495365 ATCTTTGTAGAGAAAGGATAGGG - Intronic
907462798 1:54615273-54615295 ATCTCTGCAGAGAAAGGACTTGG + Intronic
907621669 1:55987581-55987603 ATCTCTACAAAACAAGGGTAAGG + Intergenic
908285725 1:62597460-62597482 ATATTTGCCCAGAAAAGGTAAGG - Intronic
909267301 1:73577103-73577125 ATCTCTGCACAGGAATGGTGTGG - Intergenic
909267334 1:73577328-73577350 ATCTCTGCACAGGAAAGGTGGGG - Intergenic
909836477 1:80261090-80261112 ATCTCTGCACAGGAGGGGTAGGG - Intergenic
913182239 1:116333601-116333623 ATCTCTGTACAGAAAGCATATGG + Intergenic
914143336 1:144971430-144971452 ATCTCTGCAAAAAAAAAGTATGG - Intronic
914923343 1:151862411-151862433 ATCTCGGCCCTGAAAGGGCATGG + Intergenic
915892507 1:159784628-159784650 ATCTCAGCGTAGAAAGGGAAGGG - Intergenic
915949136 1:160176230-160176252 ATCTCGGCACTGACATGGTAAGG + Exonic
916783433 1:168061424-168061446 ATATATGCATAGAAAGGGTTTGG - Intronic
917062114 1:171052560-171052582 TTCTCTACTCAGAAAGGGAAGGG + Intronic
917062152 1:171052776-171052798 ATCTCTGCACAGAAAGCAAGGGG + Intronic
917667191 1:177236616-177236638 TGCTCTGCACAGAAAGGTCAAGG + Intronic
917732700 1:177891927-177891949 ATCTCTGCACAGGAAGAGTGGGG - Intergenic
917761725 1:178167511-178167533 ATCTTTGGACAAAATGGGTATGG + Intronic
917821582 1:178768956-178768978 ATCTCTGCACAGGAATGGTAGGG + Intronic
917821604 1:178769070-178769092 ATCTCTGCACAGGAAAGGTGGGG + Intronic
918102929 1:181392099-181392121 AGATCAGCACAGAAAGGGTAAGG + Intergenic
918241137 1:182621655-182621677 ACCTGTGCACAGATAAGGTATGG + Intergenic
918925645 1:190782343-190782365 ATCTCTGCACATGAAGGGTGTGG - Intergenic
919584262 1:199416506-199416528 ATCTTTGCACAAGAAGGGCAGGG - Intergenic
919593851 1:199537805-199537827 ATCTCTGCACAGTAAGGGTTGGG - Intergenic
920481555 1:206327023-206327045 ATCTCTGCAAAAAAAAAGTATGG + Intronic
921617808 1:217292113-217292135 ATCTCTCCACAGAAAGAAAAGGG - Intergenic
922003520 1:221504604-221504626 ATCTCTGTGCAGGAAGGGTAGGG - Intergenic
922068841 1:222170801-222170823 ATATCTGCACAGGATGGGTGGGG - Intergenic
923031425 1:230252030-230252052 ATCTCTGCCCAGGAAGGCTGGGG + Intronic
923509101 1:234634012-234634034 GTCTCTGCTGAGAAAGGGTTTGG + Intergenic
924392749 1:243580966-243580988 ATCTCTGCATAGGAGGGGTGGGG - Intronic
924426033 1:243951227-243951249 ATGTGTCCACAGAAAGGATATGG + Intergenic
924683268 1:246259993-246260015 ATCTCTGCATAAAAGGGGTAGGG + Intronic
1062828959 10:592576-592598 GTGTCTGCTTAGAAAGGGTATGG + Intronic
1065934200 10:30506105-30506127 ATCAAAGCACAGAGAGGGTAAGG - Intergenic
1068433621 10:56963391-56963413 ATCTCTGCACAGGAAGGGCAGGG - Intergenic
1069227998 10:65968550-65968572 ATCTATGCACAGAAAGGGTAGGG - Intronic
1069228016 10:65968662-65968684 ATCCCTGCAGAGAAAGTGTGGGG - Intronic
1069346517 10:67476722-67476744 ATCTATGCACAGGAAGTGTAGGG - Intronic
1069346555 10:67476947-67476969 ATCTCTGCACAGCAAGGCTGAGG - Intronic
1069346570 10:67477060-67477082 GTCTCTGCACAGGAAGGGTTGGG - Intronic
1069598186 10:69686400-69686422 AGCTCTGGCCAGAAAGGGAAAGG - Intronic
1070728378 10:78808000-78808022 ATCTCTGCACAGGCTGGGCAGGG - Intergenic
1071466896 10:85949324-85949346 ATATATGCATAGAAAGGGTCTGG - Intronic
1071894565 10:90051524-90051546 ATCCCTGCCCAGGAAGGGTAGGG + Intergenic
1071894605 10:90051739-90051761 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1072079572 10:92014934-92014956 ATCTAAGCATAGAAAAGGTATGG + Intronic
1072228644 10:93393939-93393961 TTCTCTGCAGAGAAAAGGAAAGG + Intronic
1072374818 10:94803819-94803841 ATCTCTGTACAGGAAGGGGAGGG + Intronic
1073159692 10:101380982-101381004 ATCTAAACATAGAAAGGGTACGG + Intronic
1073573723 10:104602952-104602974 ATCTCCTCACTGCAAGGGTATGG - Intergenic
1074085240 10:110204845-110204867 ATTTCTGCATAGAACAGGTAGGG - Intergenic
1074564035 10:114560465-114560487 ATCTATACATAGAAAGGGTAAGG - Intronic
1075180195 10:120204382-120204404 ATCTCTGCACAGAAAGGGTGGGG + Intergenic
1076964452 11:69285-69307 ATCTCAGCACAGGAAGGTTGGGG - Intergenic
1077226965 11:1442785-1442807 CTCCCGGCACAGTAAGGGTAGGG + Intronic
1078580441 11:12535564-12535586 CTCTCTGCACAAAATGGGTTGGG + Intergenic
1078989583 11:16632943-16632965 ATCTCTGCACAGGAAGGGTAGGG + Intronic
1079256319 11:18834432-18834454 ATCTCTGCACAGGAAGTGTCAGG + Intergenic
1079258388 11:18852829-18852851 ATCTATGCCCATGAAGGGTAGGG - Intergenic
1079258407 11:18852942-18852964 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1086042476 11:82495623-82495645 ATCTCTCTGCAGGAAGGGTAGGG + Intergenic
1086494093 11:87384788-87384810 AACTCTGCCCAAGAAGGGTAGGG - Intergenic
1086494125 11:87385010-87385032 ATGTCTGCACAGGAGGGGTGGGG - Intergenic
1087356230 11:97097931-97097953 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1088425412 11:109696556-109696578 ACCTCTGCCCAGGAAGGGTGGGG - Intergenic
1088425429 11:109696668-109696690 ATCTGTGCACAGGAAGGGTGGGG - Intergenic
1088611328 11:111580062-111580084 ATCTCTGGACAGGAAGGCTCAGG + Intergenic
1090425365 11:126603554-126603576 ATGTCTGCAGAGACAGGGTCAGG - Intronic
1090483261 11:127086577-127086599 ATCTTCACACAGGAAGGGTAGGG - Intergenic
1090551115 11:127821109-127821131 ACCTGTTCACAGAAAGGTTAGGG + Intergenic
1090629996 11:128637617-128637639 ATCTCTGCATAGGAAGGGTAGGG - Intergenic
1090658851 11:128866517-128866539 ATCTCTGCTCTGAACAGGTATGG - Intronic
1090913080 11:131138549-131138571 ATCTCTGTCCAGTAAGGTTAAGG + Intergenic
1091446078 12:544861-544883 ATCTATGCCAAGAAAGGGGAAGG - Exonic
1092104898 12:5914426-5914448 CTCTCTGCAGAGAAAGGATTTGG + Intronic
1092674510 12:10901012-10901034 ATCTCTGCACAGGAAGGGTAGGG - Intronic
1093134756 12:15437309-15437331 ATCTCTGCACATGAGGGGTGGGG - Intronic
1093539717 12:20266785-20266807 ATCTCTGCTCAGAAAGGTATGGG - Intergenic
1095400945 12:41814206-41814228 ATCTATGCCCAGGAAGGGTGGGG + Intergenic
1095626198 12:44318129-44318151 GTCTCTCCACAGAAAGTGTGGGG + Intronic
1095626252 12:44318468-44318490 ATCTATCCACAGGAAAGGTAGGG + Intronic
1095626295 12:44318694-44318716 GTCTATGCACAGGAAGGGTGGGG + Intronic
1095780029 12:46049084-46049106 ATCTCTGCACAGGAGGGATGGGG - Intergenic
1095867023 12:46983490-46983512 ATCCCTGCACAGGAAGGGTGGGG - Intergenic
1095908006 12:47397314-47397336 GTCTATGCACAGGAAGGGTGGGG - Intergenic
1095908023 12:47397421-47397443 ATCTCTGTACAGGAGGGGTGGGG - Intergenic
1095915640 12:47475229-47475251 TTCTATGTACAGGAAGGGTAGGG - Intergenic
1096189842 12:49609351-49609373 GTGTCTGCACAGGAAGGATAGGG - Intronic
1096189877 12:49609575-49609597 ATCTCTACACAGGGAGGGTGGGG - Intronic
1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG + Intergenic
1098371775 12:69767803-69767825 ATCTCTGCACAGGAAGGTTGGGG + Intronic
1099743306 12:86669290-86669312 ATCTCTGCACAGGAAAGGTGGGG - Intronic
1099768434 12:87021037-87021059 ATCTTTGTACAGAAAGAGTGGGG - Intergenic
1100615346 12:96227279-96227301 ATTTCTGCACTGAAAGGCTCTGG - Intronic
1100931919 12:99619305-99619327 GTCTATGCACAGGAAGGGTAGGG - Intronic
1105236107 13:18555012-18555034 ATCTCTGCACAGAAGAGGTGGGG + Intergenic
1105343800 13:19554792-19554814 ATTTCTGCACATAAAGGCTCAGG - Intergenic
1107297122 13:38921419-38921441 ATCTCTGCACAAAAAGGATGGGG + Intergenic
1108154925 13:47575403-47575425 ATGTCTGCATAGAAAGAGTGGGG - Intergenic
1108864945 13:54911920-54911942 ATCTCTGCGCAGAAAGGAGGAGG - Intergenic
1109078210 13:57864999-57865021 ATCTCTACATAGGAAGGGTGGGG - Intergenic
1109309154 13:60671992-60672014 ATCTCTGCACAGGAATGATGGGG + Intergenic
1109309173 13:60672104-60672126 ATCTATGCCCAGAAAGGGTGGGG + Intergenic
1109309194 13:60672219-60672241 ATCTCTGTACAGGAAAGATAGGG + Intergenic
1109309214 13:60672331-60672353 ATCTATGCACAGGAAGGGTTGGG + Intergenic
1109620611 13:64900314-64900336 TTCTCTGCACAGGAAGGGTGGGG - Intergenic
1109646374 13:65264048-65264070 ATCTCTGCACAGGAGGGGTGGGG - Intergenic
1109646415 13:65264274-65264296 ATCTCTGCACAGGAAGGGTGAGG - Intergenic
1109646435 13:65264390-65264412 ATCTCTGCACAGGAAGGATAGGG - Intergenic
1110638245 13:77791073-77791095 ATCTCTGCACAGGAAGGACAGGG - Intergenic
1110638271 13:77791296-77791318 ATCTCTGCACAGAAAGGGTGTGG - Intergenic
1110742951 13:79018853-79018875 ATCTCTGTACAGGCAGGGTGGGG + Intergenic
1110915548 13:81016247-81016269 ATTTCTGCACAGGAAGTGTGGGG + Intergenic
1110915564 13:81016359-81016381 ATTTCTGCATAGGAAGAGTAGGG + Intergenic
1110993046 13:82068841-82068863 ATCTTTGTACAGAAAGGGCAGGG + Intergenic
1110993116 13:82069294-82069316 ATCTATGCCCAGGAAGGGTGGGG + Intergenic
1111041636 13:82756948-82756970 ATCTCTGCACAAAACGGGTAGGG - Intergenic
1111144025 13:84157274-84157296 ATCTCTGCACAGAAAGGGCAAGG + Intergenic
1111496893 13:89062296-89062318 ATCTCTGCACAGGAATGGTGGGG + Intergenic
1112223288 13:97513362-97513384 ATCTCTGCACAGGAAAGATGGGG + Intergenic
1112223307 13:97513463-97513485 ATCTCTGCACAGGAATGGTGGGG + Intergenic
1112223324 13:97513575-97513597 GTCTCTGCACAGGAAGGATGGGG + Intergenic
1112223458 13:97514437-97514459 ATCTCTGCAAAGGAAGGGTGAGG + Intergenic
1114832719 14:26164326-26164348 ATCTCTGCACAACAAGGGTTGGG + Intergenic
1115662876 14:35514377-35514399 ATCTAAACATAGAAAGGGTACGG - Intergenic
1115963567 14:38862994-38863016 GTCTCTGCACAGGATGGGTGGGG + Intergenic
1116222884 14:42111499-42111521 ATCTCTGCACAGGAAGTGTGGGG + Intergenic
1116222908 14:42111613-42111635 GTCTCTGCACAGGAAGGGTGGGG + Intergenic
1116332239 14:43611679-43611701 ATCTCTGCACAGGATAAGTAGGG + Intergenic
1116574685 14:46557860-46557882 ATCTCTGCATAGGAAAGGTGAGG + Intergenic
1116574754 14:46558309-46558331 ATCTCTGTACAGAAAGAGTGGGG + Intergenic
1116781345 14:49240885-49240907 ATCTCTGCAGAGGAAGGGTGGGG + Intergenic
1117824489 14:59687617-59687639 ACCTTTGCACAGGAAAGGTAGGG - Intronic
1117824543 14:59687962-59687984 ATCTCTTCACAGGAATGGTGGGG - Intronic
1117824576 14:59688189-59688211 ATCTCTGCACAAAGAAGGTGGGG - Intronic
1120279410 14:82420112-82420134 ATCTCTGCTCAGGAAGAGTGGGG + Intergenic
1120455057 14:84719484-84719506 ATATCTGCACAGGAAGGATGGGG - Intergenic
1120788212 14:88555622-88555644 ATCTTTGCACAGCAGGGGTGGGG + Intergenic
1121537269 14:94699491-94699513 AACTCTGCACAGAAAGTCTCAGG - Intergenic
1124446048 15:29733700-29733722 ATCTGTGTACTGAAAGGGTAAGG + Intronic
1124648574 15:31457982-31458004 ATCTCTGCCCACAAAAGCTAAGG - Intergenic
1125130481 15:36278869-36278891 ATCTCTGAACAGAAAGAATGGGG + Intergenic
1125130498 15:36278982-36279004 ATCTCTGCACAAGAAGGGTGGGG + Intergenic
1125130532 15:36279179-36279201 ATCTCTGCACAGGAAGGATGGGG + Intergenic
1125371651 15:38984045-38984067 ATCTGTGCACAGGAAGGGTGGGG + Intergenic
1125383818 15:39115293-39115315 CTATCTGCACAGGAGGGGTATGG - Intergenic
1128259843 15:66225359-66225381 CTCTCTGCCCAGAAAGGCAATGG + Intronic
1130715473 15:86329498-86329520 ATCTTTGCACAGGAAGGGTGAGG - Intronic
1130715510 15:86329723-86329745 ATCTCTTCACAGAAAGAGTTTGG - Intronic
1130715525 15:86329836-86329858 ATCTCTGCACAGGAAAAGTGGGG - Intronic
1131585119 15:93684623-93684645 ATCTCTGTACAGGAAGAGTGAGG - Intergenic
1131698816 15:94910242-94910264 ATCTCTGCACAGGAAGGATGTGG + Intergenic
1132444098 15:101895898-101895920 ATCTCAGCACAGGAAGGTTGGGG + Intergenic
1132573017 16:652202-652224 ATCTCTGTCCACAAAGAGTAAGG + Intronic
1139342574 16:66278099-66278121 ATCTCTGCACAGGAAGGATGGGG - Intergenic
1139342593 16:66278212-66278234 ATCTCTGCATAGGAAGGGTGGGG - Intergenic
1139342632 16:66278425-66278447 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1140771744 16:78211899-78211921 AACTCAGCTCAGAGAGGGTAGGG - Intronic
1141043503 16:80692951-80692973 TTCTCTGCACAGATATGCTATGG - Intronic
1141800890 16:86308583-86308605 AGCACAGCACAGAAAGGGCAGGG - Intergenic
1144124829 17:12193375-12193397 CTCTGTGAACAGACAGGGTAGGG - Intergenic
1144399990 17:14886780-14886802 ATCTATGCACAGGACGGGTGGGG + Intergenic
1148979881 17:51563366-51563388 AACACTGCACAGAAAGTGGAAGG + Intergenic
1149020796 17:51962133-51962155 ATTTCTGCACAGAAAGGGTGGGG - Intronic
1149472037 17:56924753-56924775 ATCTCTGCCCAAAAGGGGTGTGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1153587513 18:6638352-6638374 ATTTCTGCACATAATGGATAAGG + Intergenic
1154513434 18:15134986-15135008 ATCTCTGCACAGAAGAGGTGGGG - Intergenic
1155676894 18:28440694-28440716 ATCTCTGCACAGAAAGAGTCGGG + Intergenic
1155676931 18:28440900-28440922 ATCTCTGCACAGAAAGAGTGGGG + Intergenic
1156084220 18:33379762-33379784 ATCTCTGCACAAGAAAGGTAGGG + Intronic
1156426604 18:37020053-37020075 ATCTCTGCACAGGTGGGGTGGGG + Intronic
1156886408 18:42140900-42140922 ATCTATGCACAGGAAGAGTGAGG - Intergenic
1156886420 18:42141012-42141034 ATCTCTGCAAAGGAAGGGTGGGG - Intergenic
1156886443 18:42141125-42141147 ATCTCTGCACAGTATGGGTGGGG - Intergenic
1157414907 18:47494094-47494116 ATATCTGCTCAAAAAGTGTAGGG + Intergenic
1157936048 18:51874175-51874197 ATATATGCACAGGAAGGGTGGGG + Intergenic
1157940335 18:51921668-51921690 ATCTATGCAGAGGAAGGGTGGGG - Intergenic
1158218436 18:55125190-55125212 ATCTCAGCAAACTAAGGGTATGG + Intergenic
1159320270 18:66838986-66839008 ATCTCTGCACAGAAAGCGTGAGG - Intergenic
1159723172 18:71919272-71919294 ATCTCTGCACCAGAATGGTAGGG - Intergenic
1160641255 19:138917-138939 ATCTCAGCACAGGAAGGTTGGGG - Intergenic
1163055954 19:14718083-14718105 AACTCTGGATAGAAATGGTATGG + Intronic
1163871270 19:19823272-19823294 ATCTCTGCACAGACAAGGAGAGG - Intergenic
1167807032 19:51794500-51794522 ATCTCTGAAAAGAAAGGGCCTGG + Intronic
1168437669 19:56334291-56334313 ATCTCTGCAAAGAAAGGGTGGGG + Intronic
925121896 2:1425338-1425360 ATGACTGCACAGAACGGGCATGG - Intronic
925633078 2:5915332-5915354 ATCTCTGAGCTGAAAGGGAAAGG + Intergenic
927617465 2:24613654-24613676 ATCTCTACACAGGAAGGATGGGG + Intronic
927924532 2:27001572-27001594 ATCTAAACATAGAAAGGGTACGG + Intronic
928799313 2:35067770-35067792 ATTTCTGCATAGGAAGGGTGGGG - Intergenic
928916562 2:36478032-36478054 ATCTCTGCACACAAAGTGGGAGG + Intronic
930880945 2:56269583-56269605 AATTCTCCAGAGAAAGGGTATGG + Intronic
930914773 2:56673030-56673052 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
930938680 2:56986809-56986831 ATCACTTCACAGAAAGTGTGGGG - Intergenic
931745912 2:65291992-65292014 ATCTAGGCACAGAGAGGATAAGG - Intergenic
933336679 2:80967747-80967769 ATCTCTGCACAGGATGGGTGAGG - Intergenic
933336754 2:80968194-80968216 ATCTCTGAAGAGGAAGGGTGTGG - Intergenic
935215116 2:100969842-100969864 ATCTGAACACAGAAAAGGTACGG + Intronic
936820190 2:116510792-116510814 ATCTCTGAATAGGAAGGGTGAGG + Intergenic
937609247 2:123840431-123840453 ATCTCTGCACAGTAAGGGGAGGG - Intergenic
937609278 2:123840642-123840664 ATCTCTGCATAGGAAGGGTGGGG - Intergenic
937609335 2:123840987-123841009 ATCTCTGCACAGGAATGCTGTGG - Intergenic
937823216 2:126335078-126335100 GCCTCTGCACAGGAAGGATAAGG - Intergenic
937823235 2:126335192-126335214 ATCTCTGCACAAAAACGGTGAGG - Intergenic
937849991 2:126623434-126623456 ATCCCTGGGCATAAAGGGTATGG + Intergenic
937962456 2:127470746-127470768 ATTTCTCTACAGAAAGGGAAAGG - Intronic
938133854 2:128737754-128737776 ATTTCTGCAGAGAAAGTGCAGGG - Intergenic
938241803 2:129748061-129748083 ATCTCTGCTCAGGAAGGGTGGGG - Intergenic
938513680 2:131979597-131979619 ATCTCTGCACAGAAGAGGTGGGG - Intergenic
939124844 2:138165410-138165432 ATCTCTGTACAGGAAGGATGTGG - Intergenic
939247499 2:139644898-139644920 ATCTCTACACAGGAAGTGTTGGG + Intergenic
939247548 2:139645235-139645257 AACTCTGCACAGGAAGGGTGGGG + Intergenic
939247570 2:139645347-139645369 ATCTCTGTTCAGGAAGGGTAGGG + Intergenic
939247588 2:139645460-139645482 GTCTCTTCACAGAAAGGGCAGGG + Intergenic
939682863 2:145160272-145160294 AACTCTGCAGATTAAGGGTAGGG + Intergenic
940308271 2:152249663-152249685 ATCTGTTCACAGAAAGGTTCTGG - Intergenic
940404339 2:153283729-153283751 GTCTCTGCATAGGAAGGGTAAGG + Intergenic
940694016 2:156956299-156956321 ATCTCTGCACAGGCATGGTGGGG + Intergenic
942162345 2:173204568-173204590 ATCTTTGCAGGGAAAGGATATGG - Intronic
943188534 2:184646501-184646523 ATCTCTGCACAGGAAGGGTGGGG - Intronic
944607256 2:201363373-201363395 ATCTCTGCACAGGAAAGGTAGGG - Intergenic
944607316 2:201363715-201363737 ATCTATGCACAGGAAGGGTGAGG - Intergenic
945335941 2:208592571-208592593 ATCTATGCCCAGGAAGGGTACGG - Intronic
945335957 2:208592684-208592706 ATCTCTGCACAGGAAAGATGGGG - Intronic
945495001 2:210499163-210499185 ATCTCTGCACAGGCAGGGTGGGG + Intronic
948767747 2:240232277-240232299 ATCTCTGAACAGAAGGTGCAGGG - Intergenic
1168811684 20:708936-708958 TTCCCTGAACAGAAAAGGTAGGG - Intergenic
1169515491 20:6311996-6312018 ATCTCTGCACAGGATGGGTGGGG - Intergenic
1169515575 20:6312542-6312564 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1170070138 20:12357786-12357808 ATCTCTTCACAAGAAGGGTGGGG - Intergenic
1170421150 20:16194768-16194790 TTCTATGCACAGAAAGGCTCAGG - Intergenic
1171257504 20:23701272-23701294 GTCTCTGTACAGGAAGGGTAAGG - Intergenic
1171257520 20:23701385-23701407 ATCTCTGCACAGGAATGTTGGGG - Intergenic
1171264919 20:23763431-23763453 GTCTCTGTACAGGAAGGGTAAGG - Intergenic
1171274562 20:23845122-23845144 GTCTCTGCACAGGAAGAGTAAGG - Intergenic
1174312699 20:49670973-49670995 ATCTATGCACCAAAAGGGTCTGG + Intronic
1176065934 20:63194889-63194911 ATCTCTTCACAGACTGGGTGTGG + Intergenic
1176780105 21:13183299-13183321 ATCTCTGCACAGAAGAGGTGGGG + Intergenic
1177977759 21:27872316-27872338 ATCTTTGCACAGAAGAGGTGGGG + Intergenic
1178579235 21:33823675-33823697 ATCACCGCACAGAAAGGGAGAGG - Intronic
1181130556 22:20729139-20729161 ATCTCTGCACAGAAGGGCTCGGG + Intronic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
951159963 3:19407507-19407529 ATCTCTTCACAGGAGGGGTGGGG - Intronic
951193985 3:19803890-19803912 ATCGCTGCATAGGAAGGGCAGGG - Intergenic
951194007 3:19804002-19804024 ATCTTTGCACAGGAAGGGTGGGG - Intergenic
951194030 3:19804116-19804138 ATCTCTGCACAGAGAGGATGGGG - Intergenic
951261291 3:20512397-20512419 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
951325397 3:21296857-21296879 ATTTATGCACAGGAAGGGTGGGG - Intergenic
952197981 3:31096215-31096237 ATTTAGGTACAGAAAGGGTAGGG - Intergenic
952330211 3:32357629-32357651 CTCTCTGCCCAGAAAAGGTGGGG + Intronic
954274896 3:49535751-49535773 CTCCCAGCACAGAAATGGTAAGG - Intergenic
954433424 3:50483451-50483473 TTCTCGGCAAAGAAAGGGAAGGG - Intronic
954485952 3:50851371-50851393 ATCTCTGCGCAGTAAGGGTGGGG + Intronic
955706552 3:61733407-61733429 ATCTAGGCACAGAATGGTTAAGG - Intronic
956783869 3:72626033-72626055 ATCTAAACACAGAAAAGGTACGG + Intergenic
957227242 3:77465374-77465396 CTCTCTGCACAGAAAGGAAATGG + Intronic
957563296 3:81853943-81853965 ATATATGCACAGAATGAGTAAGG + Intergenic
957922181 3:86760082-86760104 ATCTCTGCAGGGAAAGCTTATGG - Intergenic
958156432 3:89761540-89761562 ATCTCTGCACAGGAAGGGTGAGG + Intergenic
958256373 3:91330555-91330577 ATCTCTGCACAGAATGGATGGGG + Intergenic
959430641 3:106251294-106251316 GTCTCTTCACAGCAAGGGAATGG - Intergenic
959918861 3:111848774-111848796 ATCTCAACACAGAAAAGGTAAGG - Intronic
959948118 3:112149034-112149056 ATCTCTGCACAGGAGGGGTAGGG + Intronic
959948138 3:112149147-112149169 ATCTCTGCACAGGAAGTGGGGGG + Intronic
959948173 3:112149371-112149393 ATCTCTGCACAGAAAGGATGGGG + Intronic
960140159 3:114143953-114143975 ATCTATGCAATGAAAGGGTTGGG + Intronic
961233934 3:125347302-125347324 ATTTCTGCAAAGAAAGGTTCTGG - Intronic
962030762 3:131597986-131598008 GTCTCTGCACTGCAAGGGGAAGG + Intronic
962911531 3:139855688-139855710 ATCTCTGCATAGGAAGGGTGGGG + Intergenic
962911587 3:139856023-139856045 ATCTCTGCACAAGAAGAGTAGGG + Intergenic
962911609 3:139856135-139856157 ATCCCTGCACTGGAAGGGCAGGG + Intergenic
964057961 3:152484651-152484673 TTCTCTGCACAGAGAGGTCAGGG + Intergenic
964652375 3:159026334-159026356 ATCTCTGCACAGGAAAGGTAGGG + Intronic
964652392 3:159026447-159026469 ATCTCTGCACAAGAAGGGTAGGG + Intronic
964652411 3:159026559-159026581 GTCTATGCACAGGAAGGATAGGG + Intronic
964700396 3:159559201-159559223 AACTCTGCACAGATAGAGAAAGG + Intronic
964919150 3:161875188-161875210 ATCTCTGCACAGGAAATGTGGGG - Intergenic
965940112 3:174169216-174169238 ATCTCTGCACAAGAAGAGTGGGG + Intronic
965940140 3:174169442-174169464 ATCTGTGCACAGTAAGGGTGAGG + Intronic
966459969 3:180165768-180165790 ATCTCTGCACAGAAGGGGTGGGG + Intergenic
966460006 3:180165984-180166006 GTCTATGCACAGGAAGGGTGGGG + Intergenic
966473243 3:180316298-180316320 ATCTCTGCACTGAAATCTTAAGG - Intergenic
966738106 3:183206472-183206494 ATCTCTTCACTGAAAGGTTGAGG - Intronic
967732462 3:192918411-192918433 AACCCTGCCCAGAAAGGGGATGG - Intergenic
967858750 3:194136473-194136495 ATCTGAGCACAGAAAGGTAAGGG + Exonic
969365684 4:6692968-6692990 GTTTCTACACAGAAAGGGGAGGG - Intergenic
969905974 4:10396282-10396304 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
969906003 4:10396504-10396526 ATCTCTGCACAGGAAAGGTGGGG + Intergenic
970067502 4:12115887-12115909 ATCTCTGCACAGGAATGATAGGG + Intergenic
970311556 4:14787667-14787689 ATCTCTACACAGAAGTGGTAGGG - Intergenic
970668475 4:18366584-18366606 ATCTCTGCACAGGAAGGATAGGG - Intergenic
971949997 4:33332511-33332533 ATCTATGCACAGGAAGGTTGGGG - Intergenic
971950047 4:33332840-33332862 ATCTCTGCATAGGAAGGGTGGGG - Intergenic
971958380 4:33453535-33453557 ATCTCTGCACTGGAAGGGTGGGG - Intergenic
972824157 4:42737088-42737110 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
973001881 4:44961668-44961690 ATCTATGCACACAAAGGGTGGGG + Intergenic
973212292 4:47630086-47630108 ATCTCTGCACACATAGGTTTGGG + Intronic
974126819 4:57706892-57706914 GTCTCTGCAAAGGAAGGGTGAGG + Intergenic
974312758 4:60233899-60233921 ATCTCTGCACAGGAAGGATGGGG + Intergenic
974785809 4:66618770-66618792 ATCCCTGCATAGAAAGAGTAAGG + Intergenic
974785876 4:66619202-66619224 ATCTCTGCACAGGAGGGGTAGGG + Intergenic
974785910 4:66619428-66619450 ATCTCTGCACAGGAAGGGTAGGG + Intergenic
975276335 4:72505947-72505969 ATCTCTGAACAAAAAGAGTGGGG + Intronic
975969490 4:80016365-80016387 ATGTCAGCAAAGAAAGGGGATGG - Intronic
979150750 4:117311148-117311170 ATCTCTGCACAGAATTAGTAGGG + Intergenic
979737449 4:124104826-124104848 AATTCTGCACAGGAAGGGTGTGG + Intergenic
979913764 4:126404687-126404709 ATCCCTGCACAGGAAGAGTGGGG - Intergenic
979913784 4:126404801-126404823 ATTTCTGTACAGAAGGAGTAGGG - Intergenic
979913830 4:126405136-126405158 ATCTCTGCACAGAAAGGGTCAGG - Intergenic
980023818 4:127740632-127740654 ATGTCTGCACAGGAAGGATGGGG + Intronic
980023833 4:127740732-127740754 ATCTCTGCAAAGGAAGGGTGGGG + Intronic
980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG + Intronic
980032252 4:127844725-127844747 ATCTGTGCACAGGAAGGGAGGGG - Intergenic
980544043 4:134233986-134234008 ATCTCTGAAAAGACAGGATAGGG + Intergenic
981679604 4:147381636-147381658 ATCTCTGCACAGGATGGGTGGGG - Intergenic
981739253 4:147985156-147985178 GTCTCTGCACAAGAAGGGAAGGG + Intronic
981987424 4:150874903-150874925 ATCTCTGCAAAGGAAGAGTGGGG - Intronic
982475320 4:155843234-155843256 CTCTCTGCACAAATAGGGAAGGG - Intronic
982647023 4:158037173-158037195 ATCTGTGCACAGGAAGGGTGGGG - Intergenic
982647040 4:158037286-158037308 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
982843770 4:160224195-160224217 ATCTATGCACAAGAAGGGTGGGG + Intergenic
983474317 4:168195878-168195900 ATCTCTGCACAGGAGGGGTGAGG - Intergenic
983560588 4:169097522-169097544 AATTCTGCACAGGAAGGCTAAGG - Intronic
986220813 5:5767170-5767192 ATCTGGGCACAGAAAGGTAAAGG - Intergenic
987040099 5:14054393-14054415 ATCTAAACACAGAAAAGGTACGG - Intergenic
987810993 5:22836026-22836048 ATGTCTGCATAGGAAGAGTATGG + Intronic
988646909 5:33105021-33105043 ATCTCTGCACAGGAAGAGTAGGG + Intergenic
988646948 5:33105246-33105268 ATCTATGCACGGGAAGGGTGGGG + Intergenic
989447012 5:41541816-41541838 ATCTCTGCACAGAAAGGGAGGGG + Intergenic
989564382 5:42887261-42887283 GTCTTTGCACAGACAGGGTGTGG + Intronic
993009086 5:82459312-82459334 ATCTCTGCACAGGAAAGGTGAGG - Intergenic
993364579 5:87020098-87020120 ACCTCTGCACAGGAAGGGAGGGG + Intergenic
993971930 5:94430053-94430075 ATCTCTGCACAGGAGGGGTGGGG + Intronic
994399674 5:99263808-99263830 ATCTATGCACAAGAAGGGTGGGG - Intergenic
994824782 5:104698990-104699012 ATCTCTGCACAGGAAGGGTAGGG - Intergenic
994944886 5:106374808-106374830 ATCTGTACACACAAAGGCTATGG + Intergenic
995148212 5:108810642-108810664 GTCTCTGCACAGGAATGGTGGGG + Intronic
995148247 5:108810863-108810885 ATCTTTGCACAGAAAGGGTAGGG + Intronic
995148295 5:108811088-108811110 ATCTATGTCCAGGAAGGGTAGGG + Intronic
995318533 5:110804025-110804047 ATCTCTGTACAGGAATGGTGGGG + Intergenic
995834927 5:116390709-116390731 ATCTAAACACAGAAAAGGTATGG - Intronic
995918620 5:117281962-117281984 AGCTCTGGACAAAAATGGTAAGG + Intergenic
996923053 5:128790950-128790972 TTCTCTGAATAGAAAGGGGAGGG + Intronic
997840761 5:137237108-137237130 AATTCTGCACCGAAAGGGAAGGG + Intronic
998121769 5:139584185-139584207 ATATCTAAACAGAAAAGGTATGG - Intronic
998415999 5:141946474-141946496 AGCTCTTCAGAGAGAGGGTAGGG - Intronic
998448400 5:142216043-142216065 CTCTCTGCACAGACTGGTTAAGG + Intergenic
998703928 5:144737569-144737591 ATTTCTGCACAGGAGGGGTAGGG + Intergenic
998703951 5:144737684-144737706 ATCTCTGCACAGAAAGGATGGGG + Intergenic
1001647200 5:173290737-173290759 AGCTCTGCACAGAGAGGGCAGGG + Intergenic
1002736096 5:181387504-181387526 ATCTCAGCACAGGAAGGTTGGGG + Intergenic
1002748602 6:87320-87342 ATCTCAGCACAGGAAGGTTGGGG - Intergenic
1003027023 6:2564219-2564241 TCCTCTGCACAGCAAGGGAATGG - Intergenic
1004599369 6:17132899-17132921 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1004981820 6:21032627-21032649 ATCTAAACACAGAAAAGGTATGG - Intronic
1005207427 6:23420823-23420845 ATCTATGCACAGGAAGGGTAGGG - Intergenic
1005207476 6:23421156-23421178 ATCTCTGCACAGGAAGGGTAGGG - Intergenic
1005207499 6:23421270-23421292 ATCTCTGCACAGGAAGGGTAGGG - Intergenic
1006459280 6:34148933-34148955 ATCTCTGCAGGGGAAGGGGAAGG + Intronic
1007255578 6:40525889-40525911 ATTTCAGCACAGAAATGGAAAGG - Intronic
1007391009 6:41549374-41549396 ATCCCTACACAGAAAGGGACAGG - Intronic
1007687604 6:43676249-43676271 ATGTCTGCTCAGATAGGGTTAGG + Intronic
1007727954 6:43928100-43928122 ATCTCTGCAAAGAAAGGACAAGG + Intergenic
1007924473 6:45640417-45640439 GCCTCTGCACAGCAAGGGTGGGG - Intronic
1008234272 6:49025620-49025642 ATCTCTGCACAGGAAGGGCAGGG + Intergenic
1008234296 6:49025730-49025752 ATCTCTGCATAGAGGGGGTGAGG + Intergenic
1008234314 6:49025843-49025865 ATCTCTGCACAGAAAGGGTGGGG + Intergenic
1008936598 6:56999227-56999249 ATCTCTGTACAGAAAGGGTGGGG - Intronic
1008936616 6:56999358-56999380 TTCTCTGCACAAGAAGGGTGGGG - Intronic
1008998962 6:57690605-57690627 ATCTCTGCACAGAATGGATGGGG - Intergenic
1009187448 6:60589984-60590006 ATCTCTGCACAGAGTGGATGGGG - Intergenic
1010543551 6:77122857-77122879 ATCTCTGCACAGGAAGAGTGGGG + Intergenic
1010543729 6:77124367-77124389 ATCTCGGCACAAGAAGGGTGGGG - Intergenic
1010988971 6:82458274-82458296 ATCTCTACACAGGAAGGGTGGGG + Intergenic
1011311188 6:85981417-85981439 ATCTCTGCACAGGAAGTGTAGGG + Intergenic
1011321878 6:86104576-86104598 TTCTCTGCACAGGAAGGGAGGGG + Intergenic
1011519617 6:88191487-88191509 GGCTCTGCACAGAAAGGCTGTGG - Intergenic
1011786135 6:90847245-90847267 ATCTCTCTACAGAGAGTGTATGG + Intergenic
1011845814 6:91561858-91561880 ATCTCTGAGCAGGAAGGGTGGGG - Intergenic
1011954987 6:93015640-93015662 ATCCCTGCTCAGGAAGGGTGGGG - Intergenic
1011957189 6:93037645-93037667 ATCACTGCACAAGAAGGGTAGGG + Intergenic
1011957209 6:93037746-93037768 GTCTCTGCACAGGAAGGGTGGGG + Intergenic
1012103772 6:95126392-95126414 ATGTCTGCAAAGAATGGGCATGG + Intergenic
1012119004 6:95339995-95340017 ATCTCTGCACAGGAGAGGTGGGG + Intergenic
1012676090 6:102114985-102115007 ATCTCTGCACAGGAAGGGCGAGG + Intergenic
1013255391 6:108379931-108379953 CTCTCTGCACAGGAAGAGTGGGG + Intronic
1013255439 6:108380156-108380178 ATCTCTGTTCAGGAAGGGTGGGG + Intronic
1013609012 6:111776647-111776669 ATATCTTCCCAGAAAGGGTGTGG - Intronic
1015306544 6:131715368-131715390 ATCTCTGCACAGGAAGGAAGGGG - Intronic
1015306580 6:131715586-131715608 ATCCCTGCACAGGAAGGATGGGG - Intronic
1015350272 6:132210065-132210087 ATCTATACTCAGAAAGGGCAGGG + Intergenic
1015350290 6:132210176-132210198 ATCTCTGCACAGGCAGGGTGGGG + Intergenic
1015350331 6:132210407-132210429 ATCTCTGCACAGGAAGTGTGGGG + Intergenic
1016220847 6:141668459-141668481 ATCTCTGCCCAGGAAGGGTGGGG - Intergenic
1016220911 6:141668892-141668914 ATGTCTGCACAGGAAAGGTGAGG - Intergenic
1017510249 6:155108028-155108050 ATTTCTGGAAAGTAAGGGTACGG + Intronic
1019036429 6:169063389-169063411 ATAACTTCACAGAAAGGGTAGGG - Intergenic
1019241193 6:170663032-170663054 ATCTCAGCACAGGAAGGTTGGGG + Intergenic
1021189433 7:17602886-17602908 ATTTCTACACAGGAAGGGTGGGG - Intergenic
1021307027 7:19045242-19045264 GTCTCTGCACAGGAAGGGTAGGG - Intronic
1021351773 7:19602658-19602680 ATCTCTGCACAGGAATTGTGGGG + Intergenic
1021351788 7:19602749-19602771 ATCTGTGCACTGGAAGGGTGGGG + Intergenic
1021351809 7:19602863-19602885 ATCTCTGCACAGGAATTGTAGGG + Intergenic
1021351825 7:19602954-19602976 ATCTATGCACAGGAAGAGTGGGG + Intergenic
1022763739 7:33386259-33386281 ATGCATGCACTGAAAGGGTAAGG + Intronic
1023290110 7:38659837-38659859 ATCGCTGCACGGGAAGGGTGGGG - Intergenic
1023497655 7:40815446-40815468 ATCTCTGCACAAGAAGGCTGGGG + Intronic
1023497693 7:40815647-40815669 ATCTCTGCATAGGAAGGGTGGGG + Intronic
1023497711 7:40815760-40815782 ATCTCTGCACAGGAAGGATGGGG + Intronic
1024405103 7:48969978-48970000 ATCTCTGCACAGGAATGGTGAGG - Intergenic
1026229274 7:68469228-68469250 ATCTCAGCCCAGTAAGGATAAGG + Intergenic
1026258839 7:68736621-68736643 ATCTGTGCACAGACAGGGGTGGG - Intergenic
1028304504 7:89246525-89246547 ATCTCTGCACAGGAAATGTGGGG - Intronic
1028304550 7:89246863-89246885 ATCTCTGCACAGGAAGGGTGGGG - Intronic
1028333163 7:89622026-89622048 ATCTCTGCACAGGAGGCGTGTGG - Intergenic
1028333197 7:89622251-89622273 ATCTTTGCACAGGAAAGGCAGGG - Intergenic
1028351376 7:89853854-89853876 ATGACTGCACAGAAATGATAAGG + Intergenic
1028431206 7:90749254-90749276 ATCTCTGGACAGAAGGGGTGGGG - Intronic
1028431225 7:90749372-90749394 ATGTCTGCAAAGGAAGGGTGGGG - Intronic
1028868331 7:95738132-95738154 ATCTCTTCACAGAAAGGGTGGGG - Intergenic
1028868349 7:95738236-95738258 ATGTCTGCACAGGAAGGGTGGGG - Intergenic
1030407589 7:109133542-109133564 ATCTATGCCCAGAAAGGGTGGGG - Intergenic
1030754159 7:113268441-113268463 GTCTCTGCACAGGAAGGATGGGG - Intergenic
1030769338 7:113454955-113454977 ATGTCTGCACAGAAACAGTCTGG + Intergenic
1031237693 7:119197481-119197503 ATTTCTGCACAGGAAGGGCATGG - Intergenic
1031243106 7:119270892-119270914 ATCTATGCCCAGGAAGGGTGGGG + Intergenic
1031674483 7:124591850-124591872 ATCTGAGCATAGAAAAGGTACGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033540250 7:142349687-142349709 CTCTCTGCACAGAAAGGCAAGGG + Intergenic
1033555875 7:142488318-142488340 CTCTCTGCACATAAAGGCAAGGG + Intergenic
1033679802 7:143583309-143583331 ATCTCTGCACAGGAAGGAAGGGG - Intergenic
1033692033 7:143746134-143746156 ATCTCTGCACAGGAAGGAAGGGG + Intergenic
1033730969 7:144178914-144178936 ATCCCTGCACAGGAAGGATGGGG + Intergenic
1033731005 7:144179132-144179154 ATCTCTGCACAGGAAGGAAGGGG + Intergenic
1035506923 8:145063-145085 ATCTCAGCACAGGAAGGTTGGGG - Intergenic
1036469763 8:9042172-9042194 ATGTCTGCACAGAAAAGAGAAGG + Intronic
1039218834 8:35305339-35305361 ATCTCTGGACTTAAAGGGAAGGG - Intronic
1039725805 8:40215116-40215138 ATCTATAGACAGAAAGGGCAGGG - Intergenic
1041251493 8:55939226-55939248 ATCTCTGCTCACAAAGTGTTTGG - Intronic
1041445655 8:57948577-57948599 ATCTCTGCACAGCAAGACTGAGG + Intergenic
1041503567 8:58567851-58567873 ATCTAAACACAGAAAAGGTATGG + Intronic
1041887677 8:62830689-62830711 GTCTCTGCACAGGAAGGGTTGGG - Intronic
1041946814 8:63453722-63453744 ATCTCTTCATAAAAAGGTTAGGG + Intergenic
1042109652 8:65367332-65367354 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1042468609 8:69158007-69158029 AGATCTGCCTAGAAAGGGTAAGG - Intergenic
1042495723 8:69452857-69452879 ATGTTTGCACAGAAAGGATTTGG + Intergenic
1043034529 8:75179272-75179294 ATCTCTGCATGGGAAGGGTGGGG - Intergenic
1043655733 8:82662939-82662961 ATCTCCGCACAGGAAGCGGAGGG + Intergenic
1044172514 8:89072264-89072286 ATCTCTGCACTGGAAGGGGTAGG + Intergenic
1044308553 8:90666094-90666116 ATCTTTGCACAGGAAGGGTGGGG + Intronic
1044955543 8:97476004-97476026 ATCTCTGCACAGGAATGGTGGGG - Intergenic
1045010444 8:97954172-97954194 ACGTCTCCTCAGAAAGGGTAGGG - Intronic
1045094609 8:98784800-98784822 ATCTCTGCACAGGAAAAGTGGGG - Intronic
1045094628 8:98784912-98784934 ATCTCTGCACAGGAAGGGTGAGG - Intronic
1045727031 8:105186006-105186028 ATCTCTGCACAGGAAGGGTGGGG + Intronic
1046072989 8:109281672-109281694 ATGTATGCACAGGAAGGGTTGGG - Intronic
1046606309 8:116375339-116375361 ATCTGTGCACAGGAAGGGTAGGG + Intergenic
1046709652 8:117496202-117496224 ATTTCTGCACAGGAAGGGTAGGG + Intergenic
1047566253 8:126047138-126047160 ATCTCTTCACAGAAGAGGTGTGG + Intergenic
1047566272 8:126047256-126047278 ATCTCTGCACAGGAATGGTAGGG + Intergenic
1047930986 8:129728182-129728204 ATCTCTGCACAAGAGGGGTGAGG - Intergenic
1048902815 8:139056122-139056144 TTCTGTGCACAGAAATGGGAAGG - Intergenic
1048991428 8:139762578-139762600 ATCTAGACACAGAAAAGGTATGG + Intronic
1050295201 9:4197341-4197363 ATCTCTACACAAGGAGGGTAGGG - Intronic
1050619038 9:7433635-7433657 ATCTCTGCACAGGAAGGGTGTGG + Intergenic
1050619058 9:7433748-7433770 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1050619078 9:7433854-7433876 ATCTGTACACAGGAAGGGTGGGG + Intergenic
1050663285 9:7907469-7907491 AGCTCTTCACAGAATGGGTTGGG - Intergenic
1050853095 9:10313815-10313837 CTCTCTGCATAGTAAGGGAAAGG - Intronic
1051865216 9:21672929-21672951 ATTACTGCATAGCAAGGGTATGG - Intergenic
1051920317 9:22257138-22257160 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1053806423 9:41806738-41806760 CTCTCTGCAGAGGAAGGATAGGG - Intergenic
1053933999 9:43133437-43133459 AGCTCTCCAAAGAAAGGGGAAGG + Intergenic
1055736538 9:79336648-79336670 ATCTCTGCACAGGAAGGGCGAGG + Intergenic
1055818168 9:80231806-80231828 GTCTCTACACAGGAAGGGTGGGG + Intergenic
1055818193 9:80231919-80231941 TTGTCTGCACAGCAAGGGTGGGG + Intergenic
1055818225 9:80232145-80232167 ATCTCTGCACAGGAAGGGTTAGG + Intergenic
1056242485 9:84661947-84661969 ATCTAAGCACAGAAAAGGTGCGG + Intergenic
1058542745 9:106029024-106029046 ATCTCTCCAGAGAAAGAGTCTGG - Intergenic
1060314789 9:122499394-122499416 ATCTCTGCACAGGAGGGATGTGG + Intergenic
1060314828 9:122499620-122499642 ATCTCTGCACAGGAAGAATAGGG + Intergenic
1061901956 9:133677616-133677638 AGCTCTGCAAATAAAGGGTTGGG + Intronic
1203601384 Un_KI270748v1:12266-12288 ATCTCAGCACAGGAAGGTTGGGG + Intergenic
1186275452 X:7933454-7933476 ATCTCAGCACAGATATGGAAAGG - Intergenic
1188746370 X:33849765-33849787 GTATGTGCACAGAATGGGTATGG - Intergenic
1188806010 X:34590643-34590665 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1189186391 X:39059097-39059119 ATCTCTGCTTGGAAAGGGAAGGG + Intergenic
1191615673 X:63167312-63167334 ATCTCTGCACAGAGAGAGGGCGG - Intergenic
1191620625 X:63211611-63211633 ATCTCTGCACAGAGAGAGGGCGG + Intergenic
1191774043 X:64793202-64793224 GTCTCTGCACAATAAGGGTGGGG - Intergenic
1191774079 X:64793427-64793449 ATCTCTTCGCAGAAAGGATAGGG - Intergenic
1192762071 X:74104413-74104435 ATCTCTGCACAGAAAGGGTGGGG - Intergenic
1193026552 X:76851478-76851500 ATCTCTGCACAATAGGAGTAGGG + Intergenic
1193026565 X:76851589-76851611 ATCTATGCTCAGGAAGGGTCTGG + Intergenic
1193031830 X:76907082-76907104 ATTTCTGCACTGAGAGGGTGGGG - Intergenic
1193300821 X:79886551-79886573 ATCTCTGCAGGGAAAGCTTATGG + Intergenic
1193697832 X:84730483-84730505 GTCTCTGCACAGGAAGAGTGGGG + Intergenic
1193774799 X:85628462-85628484 ATCTCTGCACAGGAAGCGTGAGG + Intergenic
1193779233 X:85682805-85682827 ATCTCTGCACAGAAGGGATGGGG + Intergenic
1193779247 X:85682916-85682938 ATCTCTGCACAAGAGGGGTGGGG + Intergenic
1194157156 X:90404980-90405002 ATCTCTGAACAGGAAGGGTGAGG - Intergenic
1194172218 X:90601527-90601549 ATCTATGTTCAGAAAGAGTAAGG - Intergenic
1194172229 X:90601641-90601663 ATCTCTGCACAGGAAGGGTGGGG - Intergenic
1194333455 X:92614925-92614947 ATCTCTGCATAGTAGGGGTGAGG + Intronic
1194552843 X:95321941-95321963 ATTTCTGCAGAGGAAGGGTGGGG - Intergenic
1194552882 X:95322168-95322190 ATATATGCACAAAAAGGATAAGG - Intergenic
1194897957 X:99468999-99469021 ATCTTTGCACAGGGAGGATAGGG - Intergenic
1194897997 X:99469222-99469244 ATCTATGCACAGGAAGGGTGGGG - Intergenic
1194923519 X:99796130-99796152 ATCTCTTCACAGGAGGGGTGGGG + Intergenic
1194923577 X:99796468-99796490 ATCTCTGCACAGGAAGGGTGGGG + Intergenic
1195415831 X:104618710-104618732 TTCTCTGCACAGGAAGTGTGTGG + Intronic
1196613766 X:117743637-117743659 ATCTCTGCACAGGGAGGATAGGG - Intergenic
1197031705 X:121824070-121824092 ATCTCTGCATAGAAAGGGTGGGG - Intergenic
1197285751 X:124593250-124593272 ATCTCTGCACAGGAAGGATGGGG + Intronic
1197390801 X:125861371-125861393 GTCTCTGCTCAGGAAGGTTAGGG - Intergenic
1197412758 X:126139144-126139166 GTCTCTGCACAGGAAGGGTGAGG + Intergenic
1197412795 X:126139370-126139392 ATCTATGCATAGGAAGGGTGGGG + Intergenic
1197472846 X:126883812-126883834 ATCTCTGCACATGAGGGGTAGGG - Intergenic
1198963989 X:142208379-142208401 GTCTCTGGACAGCAAGGGAAGGG - Intergenic
1198968171 X:142250011-142250033 ATCTATGTCCAGAAAGGGTGAGG + Intergenic
1198968225 X:142250350-142250372 ATCTCTGCACAGGAGGGGTAGGG + Intergenic
1198968271 X:142250689-142250711 ATCTCTGCACAGAATGGGTGGGG + Intergenic
1198975728 X:142333502-142333524 ATCCCTACGCAGAAAAGGTAAGG - Intergenic
1198975746 X:142333616-142333638 ATCTCTGCACAGAAAAGGTGGGG - Intergenic
1199322385 X:146455749-146455771 ATCTATGCACAGGAAGGGTGGGG - Intergenic
1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG + Intronic
1200503486 Y:3981962-3981984 ATCTCTGAACAGGAAGGGTGAGG - Intergenic
1200518450 Y:4179264-4179286 ATCTATGTTCAGAAAGAGTAAGG - Intergenic
1200518460 Y:4179377-4179399 ATCTCTGCACAGGAAGGGTGGGG - Intergenic